Morpholino
MO1-pdgfra
- ID
- ZDB-MRPHLNO-140310-11
- Name
- MO1-pdgfra
- Previous Names
-
- pdgfra ATG MO (1)
- Target
- Sequence
-
5' - ATGGTCACGTAGATTGTGCTCAGCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pdgfra
No data available
Phenotype
Phenotype resulting from MO1-pdgfra
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO1-pdgfra
1 - 5 of 11 Show all
Citations
- Mao, A., Li, Z., Ning, G., Zhou, Z., Wei, C., Li, J., He, X., Wang, Q. (2023) Sclerotome-derived PDGF signaling functions as a niche cue responsible for primitive erythropoiesis. Development (Cambridge, England). 150(22):
- Damm, E.W., Clements, W.K. (2017) Pdgf signalling guides neural crest contribution to the haematopoietic stem cell specification niche. Nature cell biology. 19(5):457-467
- Kartopawiro, J., Bower, N.I., Karnezis, T., Kazenwadel, J., Betterman, K.L., Lesieur, E., Koltowska, K., Astin, J., Crosier, P., Vermeren, S., Achen, M.G., Stacker, S.A., Smith, K.A., Harvey, N.L., François, M., and Hogan, B.M. (2014) Arap3 is dysregulated in a mouse model of hypotrichosis-lymphedema-telangiectasia and regulates lymphatic vascular development. Human molecular genetics. 23(5):1286-97
1 - 3 of 3
Show