Morpholino
MO1-pin1
- ID
- ZDB-MRPHLNO-140124-1
- Name
- MO1-pin1
- Previous Names
- None
- Target
- Sequence
-
5' - ACTCTCTCTGCTCACTCTGGATGAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pin1
No data available
Phenotype
Phenotype resulting from MO1-pin1
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-pin1
1 - 5 of 8 Show all
Citations
- Liu, P.H., Shah, R.B., Li, Y., Arora, A., Ung, P.M., Raman, R., Gorbatenko, A., Kozono, S., Zhou, X.Z., Brechin, V., Barbaro, J.M., Thompson, R., White, R.M., Aguirre-Ghiso, J.A., Heymach, J.V., Lu, K.P., Silva, J.M., Panageas, K.S., Schlessinger, A., Maki, R.G., Skinner, H.D., de Stanchina, E., Sidi, S. (2019) An IRAK1-PIN1 signalling axis drives intrinsic tumour resistance to radiation therapy. Nature cell biology. 21(2):203-213
- Ibarra, M.S., Borini Etichetti, C., Di Benedetto, C., Rosano, G.L., Margarit, E., Del Sal, G., Mione, M., Girardini, J. (2017) Dynamic regulation of Pin1 expression and function during zebrafish development. PLoS One. 12:e0175939
- Bitomsky, N., Conrad, E., Moritz, C., Polonio-Vallon, T., Sombroek, D., Schultheiss, K., Glas, C., Greiner, V., Herbel, C., Mantovani, F., Del Sal, G., Peri, F., and Hofmann, T.G. (2013) Autophosphorylation and Pin1 binding coordinate DNA damage-induced HIPK2 activation and cell death. Proceedings of the National Academy of Sciences of the United States of America. 110(45):E4203-4212
1 - 3 of 3
Show