Morpholino
MO1-fga
- ID
- ZDB-MRPHLNO-140115-3
- Name
- MO1-fga
- Previous Names
-
- exon 1 (1)
- Target
- Sequence
-
5' - GCATTATATCACTCACCAATGCAGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fga
No data available
Phenotype
Phenotype resulting from MO1-fga
Phenotype of all Fish created by or utilizing MO1-fga
1 - 5 of 13 Show all
Citations
- Fish, R.J., Freire, C., Di Sanza, C., Neerman-Arbez, M. (2021) Venous Thrombosis and Thrombocyte Activity in Zebrafish Models of Quantitative and Qualitative Fibrinogen Disorders. International Journal of Molecular Sciences. 22(2):
- Freire, C., Fish, R.J., Vilar, R., Di Sanza, C., Grzegorski, S.J., Richter, C.E., Shavit, J.A., Neerman-Arbez, M. (2020) A genetic modifier of venous thrombosis in zebrafish reveals a functional role for fibrinogen AαE in early hemostasis. Blood advances. 4:5480-5491
- Vilar, R., Lukowski, S.W., Garieri, M., Di Sanza, C., Neerman-Arbez, M., Fish, R.J. (2020) Chemical Modulators of Fibrinogen Production and Their Impact on Venous Thrombosis. Thrombosis and haemostasis. 121(4):433-448
- Vo, A.H., Swaroop, A., Liu, Y., Norris, Z.G., and Shavit, J.A. (2013) Loss of fibrinogen in zebrafish results in symptoms consistent with human hypofibrinogenemia. PLoS One. 8(9):e74682
1 - 4 of 4
Show