Morpholino
MO1-aqp1a.1
- ID
- ZDB-MRPHLNO-131023-4
- Name
- MO1-aqp1a.1
- Previous Names
- None
- Target
- Sequence
-
5' - AAGCCTTGCTCTTCAGCTCGTTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-aqp1a.1
No data available
Phenotype
Phenotype resulting from MO1-aqp1a.1
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO1-aqp1a.1
1 - 5 of 17 Show all
Citations
- Goudarzi, M., Boquet-Pujadas, A., Olivo-Marin, J.C., Raz, E. (2019) Fluid dynamics during bleb formation in migrating cells in vivo. PLoS One. 14:e0212699
- Horng, J.L., Chao, P.L., Chen, P.Y., Shih, T.H., Lin, L.Y. (2015) Aquaporin 1 Is Involved in Acid Secretion by Ionocytes of Zebrafish Embryos through Facilitating CO2 Transport. PLoS One. 10:e0136440
- Talbot, K., Kwong, R.W., Gilmour, K.M., Perry, S.F. (2015) The water channel aquaporin-1a1 facilitates movement of CO2 and ammonia in zebrafish (Danio rerio) larvae. The Journal of experimental biology. 218:3931-3940
- Taloni, A., Kardash, E., Salman, O.U., Truskinovsky, L., Zapperi, S., La Porta, C.A. (2015) Volume Changes During Active Shape Fluctuations in Cells. Physical review letters. 114:208101
- Kwong, R.W., Kumai, Y., and Perry, S.F. (2013) The Role of Aquaporin and Tight Junction Proteins in the Regulation of Water Movement in Larval Zebrafish (Danio rerio). PLoS One. 8(8):e70764
1 - 5 of 5
Show