Morpholino

MO1-hace1

ID
ZDB-MRPHLNO-130913-1
Name
MO1-hace1
Previous Names
  • hace1-HECT (1)
Target
Sequence
5' - CCCTCGAACTGTTAGACAGAATAAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hace1
Expressed Gene Anatomy Figures
bmp4 Fig. 3 with image from Razaghi et al., 2017
rac1a Fig. 5 with image from Razaghi et al., 2017
Phenotype
Phenotype resulting from MO1-hace1
Phenotype of all Fish created by or utilizing MO1-hace1
Phenotype Fish Conditions Figures
cardiac ventricle elongated, abnormal AB + MO1-hace1 standard conditions Fig. 3 with image from Razaghi et al., 2017
whole organism reactive oxygen species increased amount, abnormal AB + MO1-hace1 standard conditions Fig. 4 with image from Razaghi et al., 2017
heart tubular, abnormal AB + MO1-hace1 standard conditions Fig. 1 with image from Razaghi et al., 2017
atrioventricular canal morphology, abnormal AB + MO1-hace1 standard conditions Fig. 3 with image from Razaghi et al., 2017
heart looping disrupted, abnormal AB + MO1-hace1 standard conditions Fig. 1 with image from Razaghi et al., 2017
heart bmp4 expression decreased amount, abnormal AB + MO1-hace1 standard conditions Fig. 3 with image from Razaghi et al., 2017
cardiac ventricle decreased thickness, abnormal AB + MO1-hace1 standard conditions Fig. 3 with image from Razaghi et al., 2017
heart reactive oxygen species increased amount, abnormal sd21Tg + MO1-hace1 standard conditions Fig. 4 with imageFig. 6 from Razaghi et al., 2017
heart looping disrupted, abnormal sd21Tg + MO1-hace1 standard conditions Fig. 4 with imageFig. 6 from Razaghi et al., 2017
heart inverted, abnormal twu34Tg + MO1-hace1 standard conditions Fig. 2 with image from Razaghi et al., 2017
heart tubular, abnormal twu34Tg + MO1-hace1 standard conditions Fig. 1 with image from Razaghi et al., 2017
heart morphology, abnormal twu34Tg + MO1-hace1 standard conditions Fig. 2 with image from Razaghi et al., 2017
heart looping disrupted, abnormal twu34Tg + MO1-hace1 standard conditions Fig. 1 with image from Razaghi et al., 2017
heart contraction decreased rate, abnormal twu34Tg + MO1-hace1 standard conditions Fig. 2 with image from Razaghi et al., 2017
whole organism reactive oxygen species amount, ameliorated sd21Tg + MO1-hace1 + MO1-nox1 + MO2-cybb standard conditions Fig. 6 from Razaghi et al., 2017
heart looping process quality, ameliorated sd21Tg + MO1-hace1 + MO1-nox1 + MO2-cybb standard conditions Fig. 6 from Razaghi et al., 2017
regulation of reactive oxygen species metabolic process disrupted, abnormal mitfaw2/w2; mpv17a9/a9 + MO1-hace1 standard conditions Fig. 1 from Daugaard et al., 2013
DNA damage induced protein phosphorylation increased occurrence, abnormal mitfaw2/w2; mpv17a9/a9 + MO1-hace1 standard conditions Fig. 4 from Daugaard et al., 2013
heart rac1a expression decreased amount, abnormal mitfaw2/w2; mpv17a9/a9 + MO1-hace1 standard conditions Fig. 5 with image from Razaghi et al., 2017
Citations