Morpholino

MO3-sema3e

ID
ZDB-MRPHLNO-130827-1
Name
MO3-sema3e
Previous Names
  • exon 5, sema3E MO1 (1)
Target
Sequence
5' - TTGTAGAGATGAACACTTACGGTAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sema3e
Expressed Gene Anatomy Figures
crestin Fig. 3 from Liu et al., 2019
dlx2a Fig. 3 from Liu et al., 2019
hand2 Fig. 3 from Liu et al., 2019
sox10 Fig. 3 from Liu et al., 2019
Phenotype
Phenotype resulting from MO3-sema3e
Phenotype Fish Figures
auditory capsule absent, abnormal WT + MO3-sema3e Fig. 2 from Liu et al., 2019
branchiomotor neuron mislocalised, abnormal rw0Tg + MO3-sema3e Fig. 2 from Liu et al., 2019
ceratobranchial cartilage absent, abnormal WT + MO3-sema3e Fig. 2 from Liu et al., 2019
cranial nerve X axon collateral decreased length, abnormal rw0Tg + MO3-sema3e Fig. 2 from Liu et al., 2019
eye decreased size, abnormal WT + MO3-sema3e Fig. 2 from Liu et al., 2019
head flattened, abnormal WT + MO3-sema3e Fig. 2 from Liu et al., 2019
hindbrain cranial neural crest cell distributed, abnormal rw0Tg + MO3-sema3e Fig. 4 from Liu et al., 2019
hindbrain cranial neural crest cell mislocalised, abnormal rw0Tg + MO3-sema3e Fig. 4 from Liu et al., 2019
hindbrain migratory neural crest cell dlx2a expression decreased amount, abnormal WT + MO3-sema3e Fig. 3 from Liu et al., 2019
hindbrain migratory neural crest cell hand2 expression decreased amount, abnormal WT + MO3-sema3e Fig. 3 from Liu et al., 2019
hindbrain migratory neural crest cell mislocalised, abnormal WT + MO3-sema3e Fig. 3 from Liu et al., 2019
hindbrain migratory neural crest cell crestin expression mislocalised, abnormal WT + MO3-sema3e Fig. 3 from Liu et al., 2019
hindbrain migratory neural crest cell sox10 expression mislocalised, abnormal WT + MO3-sema3e Fig. 3 from Liu et al., 2019
otolith mislocalised, abnormal WT + MO3-sema3e Fig. 2 from Liu et al., 2019
otolith organ altered number of otolith, abnormal WT + MO3-sema3e Fig. 2 from Liu et al., 2019
pharyngeal arch neural crest cell hand2 expression decreased amount, abnormal WT + MO3-sema3e Fig. 3 from Liu et al., 2019
pharyngeal arch neural crest cell dlx2a expression decreased amount, abnormal WT + MO3-sema3e Fig. 3 from Liu et al., 2019
Phenotype of all Fish created by or utilizing MO3-sema3e
Phenotype Fish Conditions Figures
pharyngeal arch neural crest cell hand2 expression decreased amount, abnormal WT + MO3-sema3e standard conditions Fig. 3 from Liu et al., 2019
hindbrain migratory neural crest cell sox10 expression mislocalised, abnormal WT + MO3-sema3e standard conditions Fig. 3 from Liu et al., 2019
auditory capsule absent, abnormal WT + MO3-sema3e standard conditions Fig. 2 from Liu et al., 2019
hindbrain migratory neural crest cell crestin expression mislocalised, abnormal WT + MO3-sema3e standard conditions Fig. 3 from Liu et al., 2019
hindbrain migratory neural crest cell hand2 expression decreased amount, abnormal WT + MO3-sema3e standard conditions Fig. 3 from Liu et al., 2019
eye decreased size, abnormal WT + MO3-sema3e standard conditions Fig. 2 from Liu et al., 2019
ceratobranchial cartilage absent, abnormal WT + MO3-sema3e standard conditions Fig. 2 from Liu et al., 2019
otolith organ altered number of otolith, abnormal WT + MO3-sema3e standard conditions Fig. 2 from Liu et al., 2019
hindbrain migratory neural crest cell dlx2a expression decreased amount, abnormal WT + MO3-sema3e standard conditions Fig. 3 from Liu et al., 2019
pharyngeal arch neural crest cell dlx2a expression decreased amount, abnormal WT + MO3-sema3e standard conditions Fig. 3 from Liu et al., 2019
hindbrain migratory neural crest cell mislocalised, abnormal WT + MO3-sema3e standard conditions Fig. 3 from Liu et al., 2019
head flattened, abnormal WT + MO3-sema3e standard conditions Fig. 2 from Liu et al., 2019
otolith mislocalised, abnormal WT + MO3-sema3e standard conditions Fig. 2 from Liu et al., 2019
branchiomotor neuron mislocalised, abnormal rw0Tg + MO3-sema3e standard conditions Fig. 2 from Liu et al., 2019
hindbrain cranial neural crest cell mislocalised, abnormal rw0Tg + MO3-sema3e standard conditions Fig. 4 from Liu et al., 2019
hindbrain cranial neural crest cell distributed, abnormal rw0Tg + MO3-sema3e standard conditions Fig. 4 from Liu et al., 2019
cranial nerve X axon collateral decreased length, abnormal rw0Tg + MO3-sema3e standard conditions Fig. 2 from Liu et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.