Morpholino
MO3-sema3e
- ID
- ZDB-MRPHLNO-130827-1
- Name
- MO3-sema3e
- Previous Names
-
- exon 5, sema3E MO1 (1)
- Target
- Sequence
-
5' - TTGTAGAGATGAACACTTACGGTAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sema3e
No data available
Phenotype
Phenotype resulting from MO3-sema3e
1 - 5 of 17 Show all
Phenotype of all Fish created by or utilizing MO3-sema3e
1 - 5 of 18 Show all
Citations
- Liu, Z.Z., Liu, L.Y., Zhu, L.Y., Zhu, J., Luo, J.Y., Wang, Y.F., Xu, H.A. (2024) Plexin B3 guides axons to cross the midline in vivo. Frontiers in Cellular Neuroscience. 18:12929691292969
- Liu, Z.Z., Guo, J., Lu, Y., Liu, W., Fu, X., Yao, T., Zhou, Y., Xu, H.A. (2019) Sema3E is required for migration of cranial neural crest cells in zebrafish: Implications for the pathogenesis of CHARGE syndrome. International journal of experimental pathology. 100(4):234-243
- Dell, A.L., Fried-Cassorla, E., Xu, H., and Raper, J.A. (2013) cAMP-Induced Expression of Neuropilin1 Promotes Retinal Axon Crossing in the Zebrafish Optic Chiasm. The Journal of neuroscience : the official journal of the Society for Neuroscience. 33(27):11076-11088
1 - 3 of 3
Show