Morpholino

MO2-zic2b

ID
ZDB-MRPHLNO-130809-1
Name
MO2-zic2b
Previous Names
  • exon 1–intron 2 splice donor site (1)
Target
Sequence
5' - ATTGAAATAATTACCAGTGTGTGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-zic2b
Expressed Gene Anatomy Figures
dlx2a Fig. 7 with image,  Fig. 8 with image from Teslaa et al., 2013
gch2 Fig. 6 with image from Teslaa et al., 2013
mitfa Fig. 6 with image from Teslaa et al., 2013
snai1b Fig. 4 with image from Teslaa et al., 2013
sox10 Fig. 5 with image from Teslaa et al., 2013
Phenotype
Phenotype resulting from MO2-zic2b
Phenotype Fish Figures
cranial neural crest mislocalised dorsally, abnormal WT + MO2-zic2b Fig. 5 with image from Teslaa et al., 2013
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO2-zic2b Fig. 1 with image from Teslaa et al., 2013
forebrain development decreased process quality, abnormal WT + MO2-zic2b Fig. 8 with image from Teslaa et al., 2013
melanoblast aggregated, abnormal WT + MO2-zic2b Fig. 6 with image from Teslaa et al., 2013
melanoblast mislocalised, abnormal WT + MO2-zic2b Fig. 6 with image from Teslaa et al., 2013
melanocyte differentiation decreased process quality, abnormal WT + MO2-zic2b Fig. 6 with image from Teslaa et al., 2013
melanocyte migration decreased process quality, abnormal WT + MO2-zic2b Fig. 6 with image from Teslaa et al., 2013
neural crest cell cellular quality, abnormal WT + MO2-zic2b Fig. 4 with image from Teslaa et al., 2013
neural crest cell differentiation decreased process quality, abnormal WT + MO2-zic2b Fig. 4 with image from Teslaa et al., 2013
neural crest cell migration decreased process quality, abnormal WT + MO2-zic2b Fig. 5 with image from Teslaa et al., 2013
pharyngeal arch 2 shortened, abnormal WT + MO2-zic2b Fig. 1 with image from Teslaa et al., 2013
pharyngeal arch cartilage hypoplastic, abnormal WT + MO2-zic2b Fig. 1 with image from Teslaa et al., 2013
trunk has fewer parts of type xanthoblast, abnormal WT + MO2-zic2b Fig. 6 with image from Teslaa et al., 2013
trunk has fewer parts of type melanoblast, abnormal WT + MO2-zic2b Fig. 6 with image from Teslaa et al., 2013
ventral mandibular arch shortened, abnormal WT + MO2-zic2b Fig. 1 with image from Teslaa et al., 2013
ventral thalamus cellular quality, abnormal WT + MO2-zic2b Fig. 8 with image from Teslaa et al., 2013
xanthophore differentiation decreased process quality, abnormal WT + MO2-zic2b Fig. 6 with image from Teslaa et al., 2013
Phenotype of all Fish created by or utilizing MO2-zic2b
Phenotype Fish Conditions Figures
neural crest cell migration decreased process quality, abnormal WT + MO2-zic2b standard conditions Fig. 5 with image from Teslaa et al., 2013
neural crest cell differentiation decreased process quality, abnormal WT + MO2-zic2b standard conditions Fig. 4 with image from Teslaa et al., 2013
ventral mandibular arch shortened, abnormal WT + MO2-zic2b standard conditions Fig. 1 with image from Teslaa et al., 2013
melanocyte differentiation decreased process quality, abnormal WT + MO2-zic2b standard conditions Fig. 6 with image from Teslaa et al., 2013
xanthophore differentiation decreased process quality, abnormal WT + MO2-zic2b standard conditions Fig. 6 with image from Teslaa et al., 2013
pharyngeal arch cartilage hypoplastic, abnormal WT + MO2-zic2b standard conditions Fig. 1 with image from Teslaa et al., 2013
neural crest cell cellular quality, abnormal WT + MO2-zic2b standard conditions Fig. 4 with image from Teslaa et al., 2013
pharyngeal arch 2 shortened, abnormal WT + MO2-zic2b standard conditions Fig. 1 with image from Teslaa et al., 2013
melanoblast aggregated, abnormal WT + MO2-zic2b standard conditions Fig. 6 with image from Teslaa et al., 2013
trunk has fewer parts of type melanoblast, abnormal WT + MO2-zic2b standard conditions Fig. 6 with image from Teslaa et al., 2013
melanoblast mislocalised, abnormal WT + MO2-zic2b standard conditions Fig. 6 with image from Teslaa et al., 2013
forebrain development decreased process quality, abnormal WT + MO2-zic2b standard conditions Fig. 8 with image from Teslaa et al., 2013
trunk has fewer parts of type xanthoblast, abnormal WT + MO2-zic2b standard conditions Fig. 6 with image from Teslaa et al., 2013
ventral thalamus cellular quality, abnormal WT + MO2-zic2b standard conditions Fig. 8 with image from Teslaa et al., 2013
cranial neural crest mislocalised dorsally, abnormal WT + MO2-zic2b standard conditions Fig. 5 with image from Teslaa et al., 2013
melanocyte migration decreased process quality, abnormal WT + MO2-zic2b standard conditions Fig. 6 with image from Teslaa et al., 2013
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO2-zic2b standard conditions Fig. 1 with image from Teslaa et al., 2013
melanocyte differentiation decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
ventral thalamus cellular quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
xanthophore differentiation decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
pharyngeal arch 3 decreased size, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
cranial neural crest mislocalised dorsally, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 5 with image from Teslaa et al., 2013
melanoblast mislocalised, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
neural crest cell differentiation decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 4 with image from Teslaa et al., 2013
head has fewer parts of type xanthoblast, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
pharyngeal arch 4 decreased size, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
pharyngeal arch 1 decreased size, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
melanocyte migration decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
pharyngeal arch 2 decreased size, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 7 with image from Teslaa et al., 2013
neural crest cell cellular quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 4 with image from Teslaa et al., 2013
neural crest cell migration decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 5 with image from Teslaa et al., 2013
trunk has fewer parts of type melanoblast, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
hypothalamus cellular quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
melanoblast aggregated, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
forebrain development decreased process quality, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 8 with image from Teslaa et al., 2013
head has fewer parts of type melanoblast, abnormal WT + MO2-zic2b + MO3-zic2a standard conditions Fig. 6 with image from Teslaa et al., 2013
rhombomere 3 decreased size, abnormal WT + MO2-zic2b + MO2-zic3 + MO3-zic2a standard conditions Fig. 6 with image from Drummond et al., 2013
rhombomere 5 decreased size, abnormal WT + MO2-zic2b + MO2-zic3 + MO3-zic2a standard conditions Fig. 6 with image from Drummond et al., 2013
motor nucleus of vagal nerve anatomical region decreased size, abnormal rw0Tg + MO2-zic2b + MO3-zic2a + MO4-tp53 standard conditions Fig. 10 with image from Drummond et al., 2013
retinoic acid receptor signaling pathway decreased process quality, abnormal sk71Tg + MO2-zic2b + MO3-zic2a + MO4-tp53 standard conditions Fig. 8 with image from Drummond et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.