Morpholino
MO3-cxxc5a
- ID
- ZDB-MRPHLNO-130729-9
- Name
- MO3-cxxc5a
- Previous Names
-
- ATG (1)
- Target
- Sequence
-
5' - CTGTCCGCCAGACATGGTCCAGCCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-cxxc5a
No data available
Phenotype
Phenotype resulting from MO3-cxxc5a
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO3-cxxc5a
1 - 5 of 12 Show all
Citations
- Peng, X., Li, G., Wang, Y., Zhuang, J., Luo, R., Chen, J., Chen, F., Shi, Y., Li, J., Zhou, Z., Mo, X., Liu, X., Yuan, W., Zeng, Q., Li, Y., Jiang, Z., Wan, Y., Ye, X., Xu, W., Wang, X., Fan, X., Zhu, P., Wu, X., Deng, Y. (2016) CXXC5 is required for cardiac looping relating to TGFβ signaling pathway in zebrafish. International Journal of Cardiology. 214:246-253
- Melvin, V.S., Feng, W., Hernandez-Lagunas, L., Artinger, K.B., and Williams, T. (2013) A morpholino-based screen to identify novel genes involved in craniofacial morphogenesis. Developmental Dynamics : an official publication of the American Association of Anatomists. 242(7):817-31
1 - 2 of 2
Show