Morpholino
MO2-adgrg6
- ID
- ZDB-MRPHLNO-130614-2
- Name
- MO2-adgrg6
- Previous Names
- None
- Target
- Sequence
-
5' - ACCGACCACTGATGAACGAAATCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-adgrg6
No data available
Phenotype
Phenotype resulting from MO2-adgrg6
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO2-adgrg6
1 - 5 of 10 Show all
Citations
- Kou, I., Takahashi, Y., Johnson, T.A., Takahashi, A., Guo, L., Dai, J., Qiu, X., Sharma, S., Takimoto, A., Ogura, Y., Jiang, H., Yan, H., Kono, K., Kawakami, N., Uno, K., Ito, M., Minami, S., Yanagida, H., Taneichi, H., Hosono, N., Tsuji, T., Suzuki, T., Sudo, H., Kotani, T., Yonezawa, I., Londono, D., Gordon, D., Herring, J.A., Watanabe, K., Chiba, K., Kamatani, N., Jiang, Q., Hiraki, Y., Kubo, M., Toyama, Y., Tsunoda, T., Wise, C.A., Qiu, Y., Shukunami, C., Matsumoto, M., and Ikegawa, S. (2013) Genetic variants in GPR126 are associated with adolescent idiopathic scoliosis. Nature Genetics. 45(6):676-679
- Patra, C., van Amerongen, M.J., Ghosh, S., Ricciardi, F., Sajjad, A., Novoyatleva, T., Mogha, A., Monk, K.R., Mühlfeld, C., and Engel, F.B. (2013) Organ-specific function of adhesion G protein-coupled receptor GPR126 is domain-dependent. Proceedings of the National Academy of Sciences of the United States of America. 110(42):16898-16903
1 - 2 of 2
Show