Morpholino
MO1-adora2aa
- ID
- ZDB-MRPHLNO-130524-2
- Name
- MO1-adora2aa
- Previous Names
- None
- Target
- Sequence
-
5' - CATTGTTCAGCATGGTGAGGTCGCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adora2aa
No data available
Phenotype
Phenotype resulting from MO1-adora2aa
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-adora2aa
1 - 4 of 4
Citations
- Fontenas, L., Welsh, T.G., Piller, M., Coughenour, P., Gandhi, A.V., Prober, D.A., Kucenas, S. (2019) The Neuromodulator Adenosine Regulates Oligodendrocyte Migration at Motor Exit Point Transition Zones. Cell Reports. 27:115-128.e5
- Haas, J., Frese, K.S., Park, Y.J., Keller, A., Vogel, B., Lindroth, A.M., Weichenhan, D., Franke, J., Fischer, S., Bauer, A., Marquart, S., Sedaghat-Hamedani, F., Kayvanpour, E., Kohler, D., Wolf, N.M., Hassel, S., Nietsch, R., Wieland, T., Ehlermann, P., Schultz, J.H., Dosch, A., Mereles, D., Hardt, S., Backs, J., Hoheisel, J.D., Plass, C., Katus, H.A., and Meder, B. (2013) Alterations in cardiac DNA methylation in human dilated cardiomyopathy. EMBO Molecular Medicine. 5(3):413-429
1 - 2 of 2
Show