Morpholino

MO2-prmt8b

ID
ZDB-MRPHLNO-130509-2
Name
MO2-prmt8b
Previous Names
  • MO2 (1)
Target
Sequence
5' - TGCTCTCCGCCTCCGCCATCTTTCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This translation-blocking Morpholino was designed to target a second AUG in prmt8b.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-prmt8b
No data available
Phenotype
Phenotype resulting from MO2-prmt8b
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO2-prmt8b Fig. S5 with image from Lin et al., 2013
axial mesoderm structural organization disrupted, abnormal WT + MO2-prmt8b Fig. 4 with image from Lin et al., 2013
brain malformed, abnormal WT + MO2-prmt8b Fig. 3 with imageFig. S1 with image from Lin et al., 2013
brain dorsal-ventral axis decreased length, abnormal WT + MO2-prmt8b Fig. 6 with image from Lin et al., 2013
brain neuron decreased amount, abnormal WT + MO2-prmt8b Fig. 6 with image from Lin et al., 2013
brain neuron disorganized, abnormal WT + MO2-prmt8b Fig. 6 with image from Lin et al., 2013
central nervous system neuron development disrupted, abnormal WT + MO2-prmt8b Fig. 6 with image from Lin et al., 2013
epiboly delayed, abnormal WT + MO2-prmt8b Fig. 3 with image from Lin et al., 2013
eye decreased size, abnormal WT + MO2-prmt8b + MO5-tp53 Fig. 3 with imageFig. S1 with image from Lin et al., 2013
germ ring increased thickness, abnormal WT + MO2-prmt8b Fig. 3 with image from Lin et al., 2013
heart edematous, abnormal WT + MO2-prmt8b Fig. 3 with imageFig. S1 with image from Lin et al., 2013
midbrain decreased size, abnormal WT + MO2-prmt8b Fig. 6 with image from Lin et al., 2013
midbrain decreased width, abnormal WT + MO2-prmt8b Fig. 6 with image from Lin et al., 2013
notochord increased width, abnormal WT + MO2-prmt8b Fig. 4 with image from Lin et al., 2013
notochord shortened, abnormal WT + MO2-prmt8b Fig. 4 with image from Lin et al., 2013
post-vent region curved, abnormal WT + MO2-prmt8b Fig. 3 with imageFig. S1 with image from Lin et al., 2013
spinal cord neuron decreased amount, abnormal WT + MO2-prmt8b Fig. 6 with image from Lin et al., 2013
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-prmt8b Fig. 4 with image from Lin et al., 2013
yolk swollen, abnormal WT + MO2-prmt8b + MO5-tp53 Fig. 3 with imageFig. S1 with image from Lin et al., 2013
Phenotype of all Fish created by or utilizing MO2-prmt8b
Phenotype Fish Conditions Figures
brain dorsal-ventral axis decreased length, abnormal WT + MO2-prmt8b standard conditions Fig. 6 with image from Lin et al., 2013
yolk swollen, abnormal WT + MO2-prmt8b standard conditions Fig. 3 with image from Lin et al., 2013
notochord shortened, abnormal WT + MO2-prmt8b standard conditions Fig. 4 with image from Lin et al., 2013
midbrain decreased size, abnormal WT + MO2-prmt8b standard conditions Fig. 6 with image from Lin et al., 2013
epiboly delayed, abnormal WT + MO2-prmt8b standard conditions Fig. 3 with image from Lin et al., 2013
midbrain decreased width, abnormal WT + MO2-prmt8b standard conditions Fig. 6 with image from Lin et al., 2013
brain malformed, abnormal WT + MO2-prmt8b standard conditions Fig. 3 with image from Lin et al., 2013
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-prmt8b standard conditions Fig. 4 with image from Lin et al., 2013
post-vent region curved, abnormal WT + MO2-prmt8b standard conditions Fig. 3 with image from Lin et al., 2013
axial mesoderm structural organization disrupted, abnormal WT + MO2-prmt8b standard conditions Fig. 4 with image from Lin et al., 2013
notochord increased width, abnormal WT + MO2-prmt8b standard conditions Fig. 4 with image from Lin et al., 2013
brain neuron disorganized, abnormal WT + MO2-prmt8b standard conditions Fig. 6 with image from Lin et al., 2013
germ ring increased thickness, abnormal WT + MO2-prmt8b standard conditions Fig. 3 with image from Lin et al., 2013
heart edematous, abnormal WT + MO2-prmt8b standard conditions Fig. 3 with image from Lin et al., 2013
eye decreased size, abnormal WT + MO2-prmt8b standard conditions Fig. 3 with image from Lin et al., 2013
brain neuron decreased amount, abnormal WT + MO2-prmt8b standard conditions Fig. 6 with image from Lin et al., 2013
apoptotic process increased occurrence, abnormal WT + MO2-prmt8b standard conditions Fig. S5 with image from Lin et al., 2013
central nervous system neuron development disrupted, abnormal WT + MO2-prmt8b standard conditions Fig. 6 with image from Lin et al., 2013
spinal cord neuron decreased amount, abnormal WT + MO2-prmt8b standard conditions Fig. 6 with image from Lin et al., 2013
brain malformed, abnormal WT + MO2-prmt8b + MO5-tp53 standard conditions Fig. S1 with image from Lin et al., 2013
heart edematous, abnormal WT + MO2-prmt8b + MO5-tp53 standard conditions Fig. S1 with image from Lin et al., 2013
post-vent region curved, abnormal WT + MO2-prmt8b + MO5-tp53 standard conditions Fig. S1 with image from Lin et al., 2013
eye decreased size, abnormal WT + MO2-prmt8b + MO5-tp53 standard conditions Fig. S1 with image from Lin et al., 2013
yolk swollen, abnormal WT + MO2-prmt8b + MO5-tp53 standard conditions Fig. S1 with image from Lin et al., 2013
Citations