Morpholino
MO1-opa1
- ID
- ZDB-MRPHLNO-130417-1
- Name
- MO1-opa1
- Previous Names
- None
- Target
- Sequence
-
5' - GATGAGTTTAGGATCTCTTTGCAGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-opa1
No data available
Phenotype
Phenotype resulting from MO1-opa1
1 - 5 of 22 Show all
Phenotype of all Fish created by or utilizing MO1-opa1
1 - 5 of 24 Show all
Citations
- Herkenne, S., Ek, O., Zamberlan, M., Pellattiero, A., Chergova, M., Chivite, I., Novotná, E., Rigoni, G., Fonseca, T.B., Samardzic, D., Agnellini, A., Bean, C., Di Benedetto, G., Tiso, N., Argenton, F., Viola, A., Soriano, M.E., Giacomello, M., Ziviani, E., Sales, G., Claret, M., Graupera, M., Scorrano, L. (2020) Developmental and Tumor Angiogenesis Requires the Mitochondria-Shaping Protein Opa1. Cell Metabolism. 31(5):987-1003.e8
- Eijkenboom, I., Vanoevelen, J.M., Hoeijmakers, J.G.J., Wijnen, I., Gerards, M., Faber, C.G., Smeets, H.J.M. (2019) A zebrafish model to study small-fiber neuropathy reveals a potential role for GDAP1. Mitochondrion. 47:273-281
- Li, J., Qi, M., Li, C., Shi, D., Zhang, D., Xie, D., Yuan, T., Feng, J., Liu, Y., Liang, D., Xu, X., Chen, J., Xu, L., Zhang, H., Ye, J., Lv, F., Huang, J., Peng, L., Chen, Y.H. (2014) Tom70 serves as a molecular switch to determine pathological cardiac hypertrophy. Cell Research. 24:977-93
- Rahn, J.J., Stackley, K.D., and Chan, S.S. (2013) Opa1 is required for proper mitochondrial metabolism in early development. PLoS One. 8(3):e59218
1 - 4 of 4
Show