Morpholino
MO1-elavl1a
- ID
- ZDB-MRPHLNO-130404-2
- Name
- MO1-elavl1a
- Previous Names
-
- ATG-MO (1)
- MO1-elavl1
- Target
- Sequence
-
5' - TGTGGTCTTCGTAACCGTTCGACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-elavl1a
No data available
Phenotype
Phenotype resulting from MO1-elavl1a
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-elavl1a
1 - 5 of 9 Show all
Citations
- Ni, S., Zhou, Y., Song, L., Chen, Y., Wang, X., Du, X., Zhang, S. (2021) ELAVL1a is an immunocompetent protein that protects zebrafish embryos from bacterial infection. Communications biology. 4:251
- Shi, B., Zhang, J., Heng, J., Gong, J., Zhang, T., Li, P., Sun, B.F., Yang, Y., Zhang, N., Zhao, Y.L., Wang, H.L., Liu, F., Zhang, Q.C., Yang, Y.G. (2020) RNA structural dynamics regulate early embryogenesis through controlling transcriptome fate and function. Genome biology. 21:120
- Poganik, J.R., Long, M.J.C., Disare, M.T., Liu, X., Chang, S.H., Hla, T., Aye, Y. (2019) Post-transcriptional regulation of Nrf2-mRNA by the mRNA-binding proteins HuR and AUF1. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 33(12):14636-14652
- Zhou, X., Wang, S., Zheng, M., Kuver, A., Wan, X., Dai, K., Li, X. (2018) Phosphorylation of ELAVL1 (Ser219/Ser316) mediated by PKC is required for erythropoiesis. Biochimica et biophysica acta. Molecular cell research. 1866(2):214-224
- Li, X., Lu, Y.C., Dai, K., Torregroza, I., Hla, T., Evans, T. (2014) Elavl1a regulates zebrafish erythropoiesis via posttranscriptional control of gata1. Blood. 123:1384-92
- Chang, S.H., Lu, Y.C., Li, X., Hsieh, W.Y., Xiong, Y., Ghosh, M., Evans, T., Elemento, O., and Hla, T. (2013) Antagonistic function of the RNA-binding protein HuR and miR-200b in post-transcriptional regulation of VEGF-A expression and angiogenesis. The Journal of biological chemistry. 288(7):4908-4921
1 - 6 of 6
Show