Morpholino
MO5-cnr1
- ID
- ZDB-MRPHLNO-130312-11
- Name
- MO5-cnr1
- Previous Names
- None
- Target
- Sequence
-
5' - GTGCTATCAACAACATACCTTTGTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-cnr1
No data available
Phenotype
Phenotype resulting from MO5-cnr1
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO5-cnr1
1 - 5 of 6 Show all
Citations
- Park, Y.M., Dahlem, C., Meyer, M.R., Kiemer, A.K., Müller, R., Herrmann, J. (2022) Induction of Liver Size Reduction in Zebrafish Larvae by the Emerging Synthetic Cannabinoid 4F-MDMB-BINACA and Its Impact on Drug Metabolism. Molecules. 27(4):
- Liu, L.Y., Alexa, K., Cortes, M., Schatzman-Bone, S., Kim, A.J., Mukhopadhyay, B., Cinar, R., Kunos, G., North, T.E., Goessling, W. (2016) Cannabinoid receptor signaling regulates liver development and metabolism. Development (Cambridge, England). 143:609-22
- Esain, V., Kwan, W., Carroll, K.J., Cortes, M., Liu, S.Y., Frechette, G.M., Sheward, L.M., Nissim, S., Goessling, W., North, T.E. (2015) Cannabinoid Receptor-2 Regulates Embryonic Hematopoietic Stem Cell Development via PGE2 and P-selectin Activity. Stem cells (Dayton, Ohio). 33(8):2596-612
- Shimada, Y., Hirano, M., Nishimura, Y., and Tanaka, T. (2012) A high-throughput fluorescence-based assay system for appetite-regulating gene and drug screening. PLoS One. 7(12):e52549
1 - 4 of 4
Show