Morpholino

MO2-appa

ID
ZDB-MRPHLNO-130125-1
Name
MO2-appa
Previous Names
  • APPa_SB (1)
Target
Sequence
5' - TAGTGTTGCTTCACCTCCTGGCAGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-appa
No data available
Phenotype
Phenotype resulting from MO2-appa
Phenotype Fish Figures
cell death increased occurrence, abnormal AB + MO2-appa Fig. 1 with image from Kaiser et al., 2012
central nervous system morphology, abnormal AB + MO2-appa Fig. 1 with image from Kaiser et al., 2012
central nervous system development disrupted, abnormal AB + MO2-appa Fig. 1 with image from Kaiser et al., 2012
cranium edematous, abnormal AB + MO2-appa Fig. 1 with image from Kaiser et al., 2012
whole organism decreased size, abnormal AB + MO2-appa Fig. 1 with image from Kaiser et al., 2012
whole organism morphology, abnormal AB + MO2-appa Fig. 3 from Kanyo et al., 2020
Phenotype of all Fish created by or utilizing MO2-appa
Phenotype Fish Conditions Figures
central nervous system morphology, abnormal AB + MO2-appa standard conditions Fig. 1 with image from Kaiser et al., 2012
cranium edematous, abnormal AB + MO2-appa standard conditions Fig. 1 with image from Kaiser et al., 2012
cell death increased occurrence, abnormal AB + MO2-appa standard conditions Fig. 1 with image from Kaiser et al., 2012
whole organism morphology, abnormal AB + MO2-appa standard conditions Fig. 3 from Kanyo et al., 2020
whole organism decreased size, abnormal AB + MO2-appa standard conditions Fig. 1 with image from Kaiser et al., 2012
central nervous system development disrupted, abnormal AB + MO2-appa standard conditions Fig. 1 with image from Kaiser et al., 2012
whole organism morphology, exacerbated prnpbua5003/ua5003 + MO2-appa (AB) standard conditions Fig. 3 from Kanyo et al., 2020
cell death increased occurrence, abnormal AB + MO1-prnpb + MO2-appa standard conditions Fig. 3 with image from Kaiser et al., 2012
central nervous system malformed, abnormal AB + MO1-prnpb + MO2-appa standard conditions Fig. 3 with image from Kaiser et al., 2012
peripheral nervous system malformed, abnormal AB + MO1-prnpb + MO2-appa standard conditions Fig. 3 with image from Kaiser et al., 2012
whole organism cell decreased adhesivity, abnormal AB + MO1-prnpb + MO2-appa standard conditions Fig. 5 with image from Kaiser et al., 2012
activation of cysteine-type endopeptidase activity involved in apoptotic process increased occurrence, abnormal AB + MO1-prnpb + MO2-appa standard conditions Fig. 4 with image from Kaiser et al., 2012
cell death increased occurrence, abnormal AB + MO2-appa + MO4-appb standard conditions Fig. 2 with image from Kaiser et al., 2012
central nervous system malformed, abnormal AB + MO2-appa + MO4-appb standard conditions Fig. 2 with image from Kaiser et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.