Morpholino
MO2-atp5if1a
- ID
- ZDB-MRPHLNO-130110-2
- Name
- MO2-atp5if1a
- Previous Names
-
- MO2-atpif1a
- Target
- Sequence
-
5' - CCTGAGCAGAAGGCGAGCCATGATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-atp5if1a
No data available
Phenotype
Phenotype resulting from MO2-atp5if1a
Phenotype | Fish | Figures |
---|---|---|
glomerular filtration disrupted, abnormal | AB/EKW + MO2-atp5if1a |
Fig. 5 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-atp5if1a
1 - 3 of 3
Citations
- Anderson, B.R., Howell, D.N., Soldano, K., Garrett, M.E., Katsanis, N., Telen, M.J., Davis, E.E., Ashley-Koch, A.E. (2015) In vivo Modeling Implicates APOL1 in Nephropathy: Evidence for Dominant Negative Effects and Epistasis under Anemic Stress. PLoS Genetics. 11:e1005349
- Shah, D.I., Takahashi-Makise, N., Cooney, J.D., Li, L., Schultz, I.J., Pierce, E.L., Narla, A., Seguin, A., Hattangadi, S.M., Medlock, A.E., Langer, N.B., Dailey, T.A., Hurst, S.N., Faccenda, D., Wiwczar, J.M., Heggers, S.K., Vogin, G., Chen, W., Chen, C., Campagna, D.R., Brugnara, C., Zhou, Y., Ebert, B.L., Danial, N.N., Fleming, M.D., Ward, D.M., Campanella, M., Dailey, H.A., Kaplan, J., and Paw, B.H. (2012) Mitochondrial Atpif1 regulates haem synthesis in developing erythroblasts. Nature. 491:608-612
1 - 2 of 2
Show