Morpholino
MO2-zfyve26
- ID
- ZDB-MRPHLNO-121220-2
- Name
- MO2-zfyve26
- Previous Names
-
- zspg15 spl (1)
- Target
- Sequence
-
5' - GAGGATGGTGTGCTTCTTACCTGTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-zfyve26
No data available
Phenotype
Phenotype resulting from MO2-zfyve26
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO2-zfyve26
1 - 5 of 20 Show all
Citations
- Novarino, G., Fenstermaker, A.G., Zaki, M.S., Hofree, M., Silhavy, J.L., Heiberg, A.D., Abdellateef, M., Rosti, B., Scott, E., Mansour, L., Masri, A., Kayserili, H., Al-Aama, J.Y., Abdel-Salam, G.M., Karminejad, A., Kara, M., Kara, B., Bozorgmehri, B., Ben-Omran, T., Mojahedi, F., Mahmoud, I.G., Bouslam, N., Bouhouche, A., Benomar, A., Hanein, S., Raymond, L., Forlani, S., Mascaro, M., Selim, L., Shehata, N., Al-Allawi, N., Bindu, P.S., Azam, M., Gunel, M., Caglayan, A., Bilguvar, K., Tolun, A., Issa, M.Y., Schroth, J., Spencer, E.G., Rosti, R.O., Akizu, N., Vaux, K.K., Johansen, A., Koh, A.A., Megahed, H., Durr, A., Brice, A., Stevanin, G., Gabriel, S.B., Ideker, T., and Gleeson, J.G. (2014) Exome sequencing links corticospinal motor neuron disease to common neurodegenerative disorders. Science (New York, N.Y.). 343(6170):506-511
- Martin, E., Yanicostas, C., Rastetter, A., Naini, S.M., Maouedj, A., Kabashi, E., Rivaud-Péchoux, S., Brice, A., Stevanin, G., and Soussi-Yanicostas, N. (2012) Spatacsin and spastizin act in the same pathway required for proper spinal motor neuron axon outgrowth in zebrafish. Neurobiology of disease. 48(3):299-308
1 - 2 of 2
Show