Morpholino

MO1-msgn1

ID
ZDB-MRPHLNO-121205-1
Name
MO1-msgn1
Previous Names
None
Target
Sequence
5' - CACATCCACGTCGATTTGCGCCATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-msgn1
Expressed Gene Anatomy Figures
msgn1 Fig. 4 with image from Yabe et al., 2012
myod1 Fig. 1 with image from Fior et al., 2012
Fig. 1 with image from Yabe et al., 2012
pcdh8 Fig. 2 with image from Yabe et al., 2012
snai1a Fig. 6 with image from Fior et al., 2012
tbx6 Fig. 1 with image from Fior et al., 2012
Fig. 2 with image from Yabe et al., 2012
tbx16l Fig. 2 with image from Fior et al., 2012
tbxta Fig. 1 with image,  Fig. 2 with image from Fior et al., 2012
Fig. 2 with image,  Fig. 4 with image from Yabe et al., 2012
wnt8a Fig. 2 with image from Fior et al., 2012
Fig. 2 with image from Yabe et al., 2012
xirp2a Fig. 1 with image,  Fig. 7 with image from Fior et al., 2012
Phenotype
Phenotype resulting from MO1-msgn1
Phenotype Fish Figures
mesodermal cell migration decreased occurrence, abnormal WT + MO1-msgn1 Fig. 5 with image from Fior et al., 2012
paraxial mesodermal cell differentiation decreased process quality, abnormal WT + MO1-msgn1 Fig. 2 with image,  Fig. 5 with image from Fior et al., 2012
paraxial mesodermal cell differentiation process quality, abnormal WT + MO1-msgn1 Fig. 6 with image from Fior et al., 2012
post-vent region has extra parts of type somite, abnormal WT + MO1-msgn1 Fig. 7 with image from Fior et al., 2012
segmental plate decreased cellular motility, abnormal WT + MO1-msgn1 Fig. 6 with image from Fior et al., 2012
segmental plate poorly differentiated, abnormal WT + MO1-msgn1 Fig. 2 with image,  Fig. 5 with image from Fior et al., 2012
somite decreased size, abnormal WT + MO1-msgn1 Fig. 7 with image from Fior et al., 2012
tail bud cellular quality, abnormal WT + MO1-msgn1 Fig. 1 with image,  Fig. 2 with image,  Fig. 6 with image from Fior et al., 2012
tail bud decreased cellular motility, abnormal WT + MO1-msgn1 Fig. 5 with image,  Fig. 6 with image from Fior et al., 2012
tail bud increased size, abnormal WT + MO1-msgn1 Fig. 1 with image from Yabe et al., 2012
Phenotype of all Fish created by or utilizing MO1-msgn1
Phenotype Fish Conditions Figures
mesodermal cell migration decreased occurrence, abnormal WT + MO1-msgn1 standard conditions Fig. 5 with image from Fior et al., 2012
segmental plate decreased cellular motility, abnormal WT + MO1-msgn1 standard conditions Fig. 6 with image from Fior et al., 2012
post-vent region has extra parts of type somite, abnormal WT + MO1-msgn1 standard conditions Fig. 7 with image from Fior et al., 2012
segmental plate poorly differentiated, abnormal WT + MO1-msgn1 standard conditions Fig. 2 with image,  Fig. 5 with image from Fior et al., 2012
paraxial mesodermal cell differentiation decreased process quality, abnormal WT + MO1-msgn1 standard conditions Fig. 2 with image,  Fig. 5 with image from Fior et al., 2012
somite decreased size, abnormal WT + MO1-msgn1 standard conditions Fig. 7 with image from Fior et al., 2012
tail bud increased size, abnormal WT + MO1-msgn1 standard conditions Fig. 1 with image from Yabe et al., 2012
tail bud cellular quality, abnormal WT + MO1-msgn1 standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 6 with image from Fior et al., 2012
paraxial mesodermal cell differentiation process quality, abnormal WT + MO1-msgn1 standard conditions Fig. 6 with image from Fior et al., 2012
tail bud decreased cellular motility, abnormal WT + MO1-msgn1 standard conditions Fig. 5 with image,  Fig. 6 with image from Fior et al., 2012
somitogenesis arrested, abnormal tbx16b104/b104 + MO1-msgn1 standard conditions Fig. 1 with image from Fior et al., 2012
tail bud increased size, abnormal tbx16b104/b104 + MO1-msgn1 standard conditions Fig. 1 with image from Fior et al., 2012
post-vent region lacks all parts of type somite, abnormal tbx16b104/b104 + MO1-msgn1 standard conditions Fig. 1 with image from Fior et al., 2012
tail bud increased size, abnormal tbx16kt378b/kt378b + MO1-msgn1 standard conditions Fig. 1 with image from Yabe et al., 2012
somitogenesis disrupted, abnormal tbx16kt378b/kt378b + MO1-msgn1 standard conditions Fig. 1 with image from Yabe et al., 2012
somatic muscle development disrupted, abnormal tbx16kt378b/kt378b + MO1-msgn1 standard conditions Fig. 1 with image from Yabe et al., 2012
trunk somite absent, abnormal tbx16kt378b/kt378b + MO1-msgn1 standard conditions Fig. 1 with image from Yabe et al., 2012
post-vent region lacks all parts of type somite, abnormal tbx16kt378b/kt378b + MO1-msgn1 standard conditions Fig. 1 with image from Yabe et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.