Morpholino
MO1-e2f8
- ID
- ZDB-MRPHLNO-121116-2
- Name
- MO1-e2f8
- Previous Names
-
- exon 2–intron 2-3 (1)
- Target
- Sequence
-
5' - AATGACTTTTTCGGATACCTGTGAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-e2f8
No data available
Phenotype
Phenotype resulting from MO1-e2f8
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-e2f8
1 - 5 of 49 Show all
Citations
- de Bruin, A., Cornelissen, P.W., Kirchmaier, B.C., Mokry, M., Iich, E., Nirmala, E., Liang, K.H., Végh, A.M., Scholman, K.T., Groot Koerkamp, M.J., Holstege, F.C., Cuppen, E., Schulte-Merker, S., Bakker, W.J. (2016) Genome-wide analysis reveals NRP1 as a direct HIF1α-E2F7 target in the regulation of motorneuron guidance in vivo. Nucleic acids research. 44(8):3549-66
- Weijts, B.G., van Impel, A., Schulte-Merker, S., and de Bruin, A. (2013) Atypical E2fs Control Lymphangiogenesis through Transcriptional Regulation of Ccbe1 and Flt4. PLoS One. 8(9):e73693
- Weijts, B.G., Bakker, W.J., Cornelissen, P.W., Liang, K.H., Schaftenaar, F.H., Westendorp, B., de Wolf, C.A., Paciejewska, M., Scheele, C.L., Kent, L., Leone, G., Schulte-Merker, S., and de Bruin, A. (2012) E2F7 and E2F8 promote angiogenesis through transcriptional activation of VEGFA in cooperation with HIF1. The EMBO journal. 31(19):3871-3884
1 - 3 of 3
Show