Morpholino

MO2-celf1

ID
ZDB-MRPHLNO-121102-3
Name
MO2-celf1
Previous Names
  • celf1_short-MO (1)
Target
Sequence
5' - GTGGTCCAGAGACCCATTCATCTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-celf1
No data available
Phenotype
Phenotype resulting from MO2-celf1
No data available
Phenotype of all Fish created by or utilizing MO2-celf1
Phenotype Fish Conditions Figures
somite shape, abnormal WT + MO1-celf1 + MO2-celf1 standard conditions Fig. S1 with image from Matsui et al., 2012
embryonic heart tube left/right pattern formation disrupted, abnormal WT + MO1-celf1 + MO2-celf1 standard conditions Fig. 3 with image from Matsui et al., 2012
heart jogging disrupted, abnormal WT + MO1-celf1 + MO2-celf1 standard conditions Fig. 3 with image from Matsui et al., 2012
somite asymmetrical, abnormal WT + MO1-celf1 + MO2-celf1 standard conditions Fig. 3 with image from Matsui et al., 2012
mRNA catabolic process disrupted, abnormal WT + MO1-celf1 + MO2-celf1 standard conditions Fig. 5 with image from Matsui et al., 2012
endoderm cell decreased amount, abnormal WT + MO1-celf1 + MO2-celf1 standard conditions Fig. 3 from Tahara et al., 2013
liver primordium aplastic/hypoplastic, abnormal WT + MO1-celf1 + MO2-celf1 standard conditions Fig. 2 from Tahara et al., 2013
pancreas primordium aplastic/hypoplastic, abnormal WT + MO1-celf1 + MO2-celf1 standard conditions Fig. 2 from Tahara et al., 2013
endoderm cell population proliferation decreased process quality, abnormal ha01Tg + MO1-celf1 + MO2-celf1 standard conditions Fig. S3 from Tahara et al., 2013
gut shape, abnormal ha01Tg + MO1-celf1 + MO2-celf1 standard conditions Fig. 1 from Tahara et al., 2013
endodermal cell cell migration process quality, abnormal ha01Tg + MO1-celf1 + MO2-celf1 standard conditions Fig. 1 from Tahara et al., 2013
embryonic digestive tract morphogenesis process quality, abnormal ha01Tg + MO1-celf1 + MO2-celf1 standard conditions Fig. 1 from Tahara et al., 2013
endodermal cell cell migration delayed, abnormal ha01Tg + MO1-celf1 + MO2-celf1 standard conditions Fig. 1 from Tahara et al., 2013
gut malformed, abnormal ha01Tg + MO1-celf1 + MO2-celf1 standard conditions Fig. 1 from Tahara et al., 2013
liver primordium aplastic/hypoplastic, abnormal ha01Tg + MO1-celf1 + MO2-celf1 standard conditions Fig. 1 from Tahara et al., 2013
pancreas primordium aplastic/hypoplastic, abnormal ha01Tg + MO1-celf1 + MO2-celf1 standard conditions Fig. 1 from Tahara et al., 2013
endoderm cell migration process quality, abnormal ha01Tg + MO1-celf1 + MO2-celf1 standard conditions Fig. 4 from Tahara et al., 2013
Citations