Morpholino
MO3-dpysl2b
- ID
- ZDB-MRPHLNO-121029-1
- Name
- MO3-dpysl2b
- Previous Names
- None
- Target
- Sequence
-
5' - CTTCTTGCCCTGATAGCCAGACATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-dpysl2b
No data available
Phenotype
Phenotype resulting from MO3-dpysl2b
1 - 5 of 13 Show all
Phenotype of all Fish created by or utilizing MO3-dpysl2b
1 - 5 of 31 Show all
Citations
- Li, S., Guo, Y., Takahashi, M., Suzuki, H., Kosaki, K., Ohshima, T. (2024) Forebrain commissure formation in zebrafish embryo requires the binding of KLC1 to CRMP2. Developmental Neurobiology. 84(3):203-216
- Guo, Y., Oliveros, C.F., Ohshima, T. (2022) CRMP2 and CRMP4 are required for the formation of commissural tracts in the developing zebrafish forebrain. Developmental Neurobiology. 82(6):533-544
- Suzuki, H., Li, S., Tokutomi, T., Takeuchi, C., Takahashi, M., Yamada, M., Okuno, H., Miya, F., Takenouchi, T., Numabe, H., Kosaki, K., Ohshima, T. (2022) De novo non-synonymous DPYSL2 (CRMP2) variants in two patients with intellectual disabilities and documentation of functional relevance through zebrafish rescue and cellular transfection experiments. Human molecular genetics. 31(24):4173-4182
- Fiallos-Oliveros, C., Ohshima, T. (2020) Dpysl2 (CRMP2) is required for the migration of facial branchiomotor neurons in the developing zebrafish embryo. The International journal of developmental biology. 64:479-484
- Liu, Z.Z., Zhu, J., Wang, C.L., Wang, X., Han, Y.Y., Liu, L.Y., Xu, H.A. (2018) CRMP2 and CRMP4 Are Differentially Required for Axon Guidance and Growth in Zebrafish Retinal Neurons. Neural Plasticity. 2018:8791304
- Morimura, R., Nozawa, K., Tanaka, H., and Ohshima, T. (2013) Phosphorylation of Dpsyl2 (CRMP2) and Dpsyl3 (CRMP4) is required for positioning of caudal primary motor neurons in the zebrafish spinal cord. Developmental Neurobiology. 73(12):911-20
- Tanaka, H., Morimura, R., and Ohshima, T. (2012) Dpysl2 (CRMP2) and Dpysl3 (CRMP4) phosphorylation by Cdk5 and DYRK2 is required for proper positioning of Rohon-Beard neurons and neural crest cells during neurulation in zebrafish. Developmental Biology. 370(2):223-236
1 - 7 of 7
Show