Morpholino
MO2-s1pr1
- ID
- ZDB-MRPHLNO-121026-2
- Name
- MO2-s1pr1
- Previous Names
- None
- Target
- Sequence
-
5' - AGTGTCTGGCGATTAGGTCATCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-s1pr1
No data available
Phenotype
Phenotype resulting from MO2-s1pr1
1 - 5 of 30 Show all
Phenotype of all Fish created by or utilizing MO2-s1pr1
1 - 5 of 40 Show all
Citations
- Guzzolino, E., Chiavacci, E., Ahuja, N., Mariani, L., Evangelista, M., Ippolito, C., Rizzo, M., Garrity, D., Cremisi, F., Pitto, L. (2018) Post-transcriptional Modulation of Sphingosine-1-Phosphate Receptor 1 by miR-19a Affects Cardiovascular Development in Zebrafish. Frontiers in cell and developmental biology. 6:58
- Mendelson, K., Zygmunt, T., Torres-Vazquez, J., Evans, T., and Hla, T. (2013) Sphingosine-1-Phosphate Receptors S1pr1 and S1pr2 Cooperatively Regulate Embryonic Vascular Development. The Journal of biological chemistry. 288(4):2143-2156
- Ben Shoham, A., Malkinson, G., Krief, S., Shwartz, Y., Ely, Y., Ferrara, N., Yaniv, K., and Zelzer, E. (2012) S1P1 inhibits sprouting angiogenesis during vascular development. Development (Cambridge, England). 139(20):3859-3869
- Tobia, C., Chiodelli, P., Nicoli, S., Dell'era, P., Buraschi, S., Mitola, S., Foglia, E., van Loenen, P.B., Alewijnse, A.E., and Presta, M. (2012) Sphingosine-1-Phosphate Receptor-1 Controls Venous Endothelial Barrier Integrity in Zebrafish. Arterioscler. Thromb. Vasc. Biol.. 32(9):e104-116
1 - 4 of 4
Show