Morpholino
MO1-cald1a
- ID
- ZDB-MRPHLNO-121022-1
- Name
- MO1-cald1a
- Previous Names
-
- Cald1a-i4e5 (1)
- Target
- Sequence
-
5' - TTATTCCCCTACAAACAGAACTGCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cald1a
No data available
Phenotype
Phenotype resulting from MO1-cald1a
Phenotype | Fish | Figures |
---|---|---|
intestine peristalsis increased occurrence, abnormal | WT + MO1-cald1a |
Fig. 4
from Abrams et al., 2012 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-cald1a
1 - 5 of 7 Show all
Citations
- Abrams, J., Einhorn, Z., Seiler, C., Zong, A.B., Sweeney, H.L., Pack, M. (2016) Graded effects of unregulated smooth muscle myosin on intestinal architecture, intestinal motility, and vascular function in zebrafish. Disease models & mechanisms. 9(5):529-40
- Abrams, J., Davuluri, G., Seiler, C., and Pack, M. (2012) Smooth muscle caldesmon modulates peristalsis in the wild type and non-innervated zebrafish intestine. Neurogastroenterology and motility. 24(3):288-299
- Seiler, C., Davuluri, G., Abrams, J., Byfield, F.J., Janmey, P.A., and Pack, M. (2012) Smooth muscle tension induces invasive remodeling of the zebrafish intestine. PLoS Biology. 10(9):e1001386
1 - 3 of 3
Show