Morpholino
MO1-hbegfa
- ID
- ZDB-MRPHLNO-121017-3
- Name
- MO1-hbegfa
- Previous Names
- None
- Target
- Sequence
-
5' - AAAGTTCATGTTTTTCCTTCAGGGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translatinon-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hbegfa
No data available
Phenotype
Phenotype resulting from MO1-hbegfa
No data available
Phenotype of all Fish created by or utilizing MO1-hbegfa
1 - 5 of 6 Show all
Citations
- Nelson, C.M., Ackerman, K.M., O'Hayer, P., Bailey, T.J., Gorsuch, R.A., and Hyde, D.R. (2013) Tumor Necrosis Factor-Alpha Is Produced by Dying Retinal Neurons and Is Required for Muller Glia Proliferation during Zebrafish Retinal Regeneration. The Journal of neuroscience : the official journal of the Society for Neuroscience. 33(15):6524-6539
- Ramachandran, R., Zhao, X.F., and Goldman, D. (2012) Insm1a-mediated gene repression is essential for the formation and differentiation of Müller glia-derived progenitors in the injured retina. Nature cell biology. 14(10):1013-1023
- Wan, J., Ramachandran, R., and Goldman, D. (2012) HB-EGF Is Necessary and Sufficient for Müller Glia Dedifferentiation and Retina Regeneration. Developmental Cell. 22(2):334-347
1 - 3 of 3
Show