Morpholino
MO1-prex1
- ID
- ZDB-MRPHLNO-121015-1
- Name
- MO1-prex1
- Previous Names
-
- Prex1 MO (1)
- Target
- Sequence
-
5' - CCTCCTCAGTGTTTATTTCGCTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-prex1
No data available
Phenotype
Phenotype resulting from MO1-prex1
| Phenotype | Fish | Figures |
|---|---|---|
| GTPase activity decreased process quality, abnormal | WT + MO1-prex1 |
Fig. 6
from Woo et al., 2012 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-prex1
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| GTPase activity decreased process quality, abnormal | WT + MO1-prex1 | standard conditions |
Fig. 6
from Woo et al., 2012 |
| endodermal cell cellular motility, abnormal | s944Tg + MO1-prex1 | standard conditions |
Fig. 6
from Woo et al., 2012 |
1 - 2 of 2
Citations
- Liu, Z., Woo, S., Weiner, O.D. (2018) Nodal signaling has dual roles in fate specification and directed migration during germ layer segregation. Development (Cambridge, England). 145(17):
- Woo, S., Housley, M.P., Weiner, O.D., and Stainier, D.Y. (2012) Nodal signaling regulates endodermal cell motility and actin dynamics via Rac1 and Prex1. The Journal of cell biology. 198(5):941-952
1 - 2 of 2
Show