Morpholino
MO1-bin1b
- ID
- ZDB-MRPHLNO-120925-2
- Name
- MO1-bin1b
- Previous Names
- None
- Target
- Sequence
-
5' - TGACTCCTTTCCCAACCTCTGCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bin1b
No data available
Phenotype
Phenotype resulting from MO1-bin1b
1 - 5 of 21 Show all
Phenotype of all Fish created by or utilizing MO1-bin1b
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
skeletal muscle nucleus aggregated, abnormal | AB + MO1-bin1b | control |
Fig. 4
from Smith et al., 2014 |
whole organism Ab1-bin1 labeling decreased amount, abnormal | AB + MO1-bin1b | control |
Fig. 2
from Smith et al., 2014 |
trunk curved dorsal, abnormal | AB + MO1-bin1b | control |
Fig. 3
from Smith et al., 2014 |
skeletal muscle cell T-tubule Ab1-bin1 labeling decreased distribution, abnormal | AB + MO1-bin1b | control |
Fig. 5
from Smith et al., 2014 |
skeletal muscle cell disorganized, abnormal | AB + MO1-bin1b | control |
Fig. 4,
Fig. 7
from Smith et al., 2014 |
1 - 5 of 21 Show all
Citations
- Smith, L.L., Gupta, V.A., and Beggs, A.H. (2014) Bridging integrator 1 (Bin1) deficiency in zebrafish results in centronuclear myopathy.. Human molecular genetics. 23(13):3566-78
- Hong, T.T., Smyth, J.W., Chu, K.Y., Vogan, J.M., Fong, T.S., Jensen, B.C., Fang, K., Halushka, M.K., Russell, S.D., Colecraft, H., Hoopes, C.W., Ocorr, K., Chi, N.C., and Shaw, R.M. (2012) BIN1 is Reduced and Cav1.2 Trafficking is Impaired in Human Failing Cardiomyocytes. Heart rhythm. 9(5):812-820
1 - 2 of 2
Show