Morpholino
MO1-jade1
- ID
- ZDB-MRPHLNO-120809-6
- Name
- MO1-jade1
- Previous Names
-
- MO1-phf17
- Target
- Sequence
-
5' - TCGGGACACGGCTTCGCTTCATCCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-jade1
No data available
Phenotype
Phenotype resulting from MO1-jade1
| Phenotype | Fish | Figures |
|---|---|---|
| whole organism increased curvature, abnormal | WT + MO1-jade1 |
Fig. 6
from Borgal et al., 2012 |
Phenotype of all Fish created by or utilizing MO1-jade1
Citations