Morpholino
MO3-nek8
- ID
- ZDB-MRPHLNO-120809-2
- Name
- MO3-nek8
- Previous Names
- None
- Target
- Sequence
-
5' - TTCTCATACTTCTCCATGTTTTCGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-nek8
No data available
Phenotype
Phenotype resulting from MO3-nek8
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO3-nek8
1 - 5 of 12 Show all
Citations
- Grampa, V., Delous, M., Zaidan, M., Odye, G., Thomas, S., Elkhartoufi, N., Filhol, E., Niel, O., Silbermann, F., Lebreton, C., Collardeau-Frachon, S., Rouvet, I., Alessandri, J.L., Devisme, L., Dieux-Coeslier, A., Cordier, M.P., Capri, Y., Khung-Savatovsky, S., Sigaudy, S., Salomon, R., Antignac, C., Gubler, M.C., Benmerah, A., Terzi, F., Attié-Bitach, T., Jeanpierre, C., Saunier, S. (2016) Novel NEK8 Mutations Cause Severe Syndromic Renal Cystic Dysplasia through YAP Dysregulation. PLoS Genetics. 12:e1005894
- Fukui, H., Shiba, D., Asakawa, K., Kawakami, K., and Yokoyama, T. (2012) The ciliary protein Nek8/Nphp9 acts downstream of Inv/Nphp2 during pronephros morphogenesis and left-right establishment in zebrafish. FEBS letters. 586(16):2273-2279
1 - 2 of 2
Show