Morpholino

MO2-vcp

ID
ZDB-MRPHLNO-120717-2
Name
MO2-vcp
Previous Names
  • CDC48-MO2 (1)
Target
Sequence
5' - TAGTTGATGGAAATGAGTAGCTCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO, targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-vcp
No data available
Phenotype
Phenotype resulting from MO2-vcp
Phenotype Fish Figures
brain apoptotic, abnormal WT + MO2-vcp Fig. S3 from Imamura et al., 2012
brain degeneration, abnormal WT + MO2-vcp Fig. 2 from Imamura et al., 2012
cranial nerve II decreased width, abnormal WT + MO2-vcp Fig. 2 from Imamura et al., 2012
diencephalon apoptotic, abnormal WT + MO2-vcp Fig. S3 from Imamura et al., 2012
diencephalon cell decreased amount, abnormal WT + MO2-vcp Fig. 2 from Imamura et al., 2012
diencephalon nucleus aggregated, abnormal WT + MO2-vcp Fig. 3 from Imamura et al., 2012
embryo development delayed, abnormal WT + MO2-vcp Fig. 1 from Imamura et al., 2012
eye apoptotic, abnormal WT + MO2-vcp Fig. S3 from Imamura et al., 2012
eye degeneration, abnormal WT + MO2-vcp Fig. 2 from Imamura et al., 2012
eye size, abnormal WT + MO2-vcp Fig. 1Fig. 4 from Imamura et al., 2012
eye nucleus aggregated, abnormal WT + MO2-vcp Fig. 3 from Imamura et al., 2012
head size, abnormal WT + MO2-vcp Fig. 1Fig. 4 from Imamura et al., 2012
motor neuron axon branched, abnormal rw0Tg + MO2-vcp Fig. 2 from Imamura et al., 2012
motor neuron axon truncated, abnormal WT + MO2-vcp Fig. 2 from Imamura et al., 2012
retinal ganglion cell layer decayed, abnormal WT + MO2-vcp Fig. 2 from Imamura et al., 2012
retinal ganglion cell layer neuron degenerate, abnormal WT + MO2-vcp Fig. 3 from Imamura et al., 2012
retinal inner plexiform layer decayed, abnormal WT + MO2-vcp Fig. 2 from Imamura et al., 2012
retinal inner plexiform layer neuron degenerate, abnormal WT + MO2-vcp Fig. 3 from Imamura et al., 2012
trunk curved ventral, abnormal WT + MO2-vcp Fig. 1Fig. 4Fig. S2 from Imamura et al., 2012
Phenotype of all Fish created by or utilizing MO2-vcp
Phenotype Fish Conditions Figures
eye size, abnormal WT + MO2-vcp standard conditions Fig. 1Fig. 4 from Imamura et al., 2012
eye degeneration, abnormal WT + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
cranial nerve II decreased width, abnormal WT + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
diencephalon cell decreased amount, abnormal WT + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
motor neuron axon branched, abnormal WT + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
eye nucleus aggregated, abnormal WT + MO2-vcp standard conditions Fig. 3 from Imamura et al., 2012
retinal ganglion cell layer neuron degenerate, abnormal WT + MO2-vcp standard conditions Fig. 3 from Imamura et al., 2012
trunk curved ventral, abnormal WT + MO2-vcp standard conditions Fig. 1Fig. 4Fig. S2 from Imamura et al., 2012
brain apoptotic, abnormal WT + MO2-vcp standard conditions Fig. S3 from Imamura et al., 2012
eye apoptotic, abnormal WT + MO2-vcp standard conditions Fig. S3 from Imamura et al., 2012
embryo development delayed, abnormal WT + MO2-vcp standard conditions Fig. 1 from Imamura et al., 2012
retinal ganglion cell layer decayed, abnormal WT + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
motor neuron axon truncated, abnormal WT + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
diencephalon apoptotic, abnormal WT + MO2-vcp standard conditions Fig. S3 from Imamura et al., 2012
retinal inner plexiform layer neuron degenerate, abnormal WT + MO2-vcp standard conditions Fig. 3 from Imamura et al., 2012
head size, abnormal WT + MO2-vcp standard conditions Fig. 1Fig. 4 from Imamura et al., 2012
retinal inner plexiform layer decayed, abnormal WT + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
brain degeneration, abnormal WT + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
diencephalon nucleus aggregated, abnormal WT + MO2-vcp standard conditions Fig. 3 from Imamura et al., 2012
motor neuron axon branched, abnormal rw0Tg + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
motor neuron axon truncated, abnormal rw0Tg + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
Citations