Morpholino
MO1-plxna1b
- ID
- ZDB-MRPHLNO-120627-2
- Name
- MO1-plxna1b
- Previous Names
-
- MO1-plxna1
- Target
- Sequence
-
5' - GCCACATATCTGCACTGGTCCTTGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-plxna1b
No data available
Phenotype
Phenotype resulting from MO1-plxna1b
from 1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-plxna1b
1 - 2 of 2
Citations
- Dworschak, G.C., Punetha, J., Kalanithy, J.C., Mingardo, E., Erdem, H.B., Akdemir, Z.C., Karaca, E., Mitani, T., Marafi, D., Fatih, J.M., Jhangiani, S.N., Hunter, J.V., Dakal, T.C., Dhabhai, B., Dabbagh, O., Alsaif, H.S., Alkuraya, F.S., Maroofian, R., Houlden, H., Efthymiou, S., Dominik, N., Salpietro, V., Sultan, T., Haider, S., Bibi, F., Thiele, H., Hoefele, J., Riedhammer, K.M., Wagner, M., Guella, I., Demos, M., Keren, B., Buratti, J., Charles, P., Nava, C., Héron, D., Heide, S., Valkanas, E., Waddell, L.B., Jones, K.J., Oates, E.C., Cooper, S.T., MacArthur, D., Syrbe, S., Ziegler, A., Platzer, K., Okur, V., Chung, W.K., O'Shea, S.A., Alcalay, R., Fahn, S., Mark, P.R., Guerrini, R., Vetro, A., Hudson, B., Schnur, R.E., Hoganson, G.E., Burton, J.E., McEntagart, M., Lindenberg, T., Yilmaz, Ö., Odermatt, B., Pehlivan, D., Posey, J.E., Lupski, J.R., Reutter, H. (2021) Biallelic and monoallelic variants in PLXNA1 are implicated in a novel neurodevelopmental disorder with variable cerebral and eye anomalies. Genetics in medicine : official journal of the American College of Medical Genetics. 23(9):1715-1725
- Jacob, L., Sawma, P., Garnier, N., Meyer, L.A., Fritz, J., Hussenet, T., Spenlé, C., Goetz, J., Vermot, J., Fernandez, A., Baumlin, N., Aci-Sèche, S., Orend, G., Roussel, G., Crémel, G., Genest, M., Hubert, P., Bagnard, D. (2016) Inhibition of PlexA1-mediated brain tumor growth and tumor-associated angiogenesis using a transmembrane domain targeting peptide. Oncotarget. 7:57851-57865
- Ton, Q.V., and Iovine, M.K. (2012) Semaphorin3d mediates Cx43-dependent phenotypes during fin regeneration. Developmental Biology. 366(2):195-203
1 - 3 of 3
Show