Morpholino

MO2-actn2b

ID
ZDB-MRPHLNO-120524-7
Name
MO2-actn2b
Previous Names
  • E2-I2 (1)
Target
Sequence
5' - AGAAAGTTCAGTGTGTTAACCTGAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-actn2b
No data available
Phenotype
Phenotype resulting from MO2-actn2b
Phenotype Fish Figures
atrium increased size, abnormal AB + MO2-actn2b Fig. 5 from Gupta et al., 2012
atrium lacks parts or has fewer parts of type cardiac muscle cell sarcomere, abnormal AB + MO2-actn2b Fig. 8 from Gupta et al., 2012
atrium lacks parts or has fewer parts of type cardiac muscle cell Z disc, abnormal AB + MO2-actn2b Fig. 8 from Gupta et al., 2012
cardiac muscle myofibril disorganized, abnormal AB + MO2-actn2b Fig. 8 from Gupta et al., 2012
cardiac muscle cell Z disc decreased size, abnormal AB + MO2-actn2b Fig. 8 from Gupta et al., 2012
cardiac ventricle increased size, abnormal AB + MO2-actn2b Fig. 5 from Gupta et al., 2012
eye decreased size, abnormal AB + MO2-actn2b Fig. 5 from Gupta et al., 2012
eye lacks all parts of type retinal photoreceptor layer, abnormal AB + MO2-actn2b Fig. S2 from Gupta et al., 2012
heart increased size, abnormal AB + MO2-actn2b Fig. 5 from Gupta et al., 2012
heart contraction decreased rate, abnormal AB + MO2-actn2b text only from Gupta et al., 2012
lens cell nucleate quality, abnormal AB + MO2-actn2b Fig. S2 from Gupta et al., 2012
sarcomere organization disrupted, abnormal AB + MO2-actn2b Fig. 7 from Gupta et al., 2012
skeletal muscle lacks parts or has fewer parts of type slow muscle cell myofibril, abnormal AB + MO2-actn2b Fig. 7 from Gupta et al., 2012
skeletal muscle morphology, abnormal AB + MO2-actn2b Fig. 5 from Gupta et al., 2012
skeletal muscle contractile muscle fiber decreased size, abnormal AB + MO2-actn2b Fig. 5 from Gupta et al., 2012
skeletal muscle myofibril morphology, abnormal AB + MO2-actn2b Fig. 5 from Gupta et al., 2012
slow muscle cell decreased amount, abnormal AB + MO2-actn2b Fig. 7 from Gupta et al., 2012
slow muscle cell decreased diameter, abnormal AB + MO2-actn2b Fig. 7 from Gupta et al., 2012
slow muscle cell myofibril disorganized, abnormal AB + MO2-actn2b Fig. 7 from Gupta et al., 2012
slow muscle cell nucleus circular, abnormal AB + MO2-actn2b Fig. 7 from Gupta et al., 2012
swimming behavior decreased process quality, abnormal AB + MO2-actn2b Fig. 6 from Gupta et al., 2012
thigmotaxis decreased process quality, abnormal AB + MO2-actn2b Fig. 6 from Gupta et al., 2012
whole organism decreased size, abnormal AB + MO2-actn2b Fig. 5 from Gupta et al., 2012
whole organism refractivity, abnormal AB + MO2-actn2b Fig. 5 from Gupta et al., 2012
Phenotype of all Fish created by or utilizing MO2-actn2b
Phenotype Fish Conditions Figures
skeletal muscle lacks parts or has fewer parts of type slow muscle cell myofibril, abnormal AB + MO2-actn2b standard conditions Fig. 7 from Gupta et al., 2012
slow muscle cell myofibril disorganized, abnormal AB + MO2-actn2b standard conditions Fig. 7 from Gupta et al., 2012
sarcomere organization disrupted, abnormal AB + MO2-actn2b standard conditions Fig. 7 from Gupta et al., 2012
skeletal muscle contractile muscle fiber decreased size, abnormal AB + MO2-actn2b standard conditions Fig. 5 from Gupta et al., 2012
cardiac muscle cell Z disc decreased size, abnormal AB + MO2-actn2b standard conditions Fig. 8 from Gupta et al., 2012
thigmotaxis decreased process quality, abnormal AB + MO2-actn2b standard conditions Fig. 6 from Gupta et al., 2012
slow muscle cell nucleus circular, abnormal AB + MO2-actn2b standard conditions Fig. 7 from Gupta et al., 2012
swimming behavior decreased process quality, abnormal AB + MO2-actn2b standard conditions Fig. 6 from Gupta et al., 2012
skeletal muscle morphology, abnormal AB + MO2-actn2b standard conditions Fig. 5 from Gupta et al., 2012
slow muscle cell decreased amount, abnormal AB + MO2-actn2b standard conditions Fig. 7 from Gupta et al., 2012
skeletal muscle myofibril morphology, abnormal AB + MO2-actn2b standard conditions Fig. 5 from Gupta et al., 2012
cardiac ventricle increased size, abnormal AB + MO2-actn2b standard conditions Fig. 5 from Gupta et al., 2012
heart contraction decreased rate, abnormal AB + MO2-actn2b standard conditions text only from Gupta et al., 2012
atrium increased size, abnormal AB + MO2-actn2b standard conditions Fig. 5 from Gupta et al., 2012
whole organism decreased size, abnormal AB + MO2-actn2b standard conditions Fig. 5 from Gupta et al., 2012
eye lacks all parts of type retinal photoreceptor layer, abnormal AB + MO2-actn2b standard conditions Fig. S2 from Gupta et al., 2012
lens cell nucleate quality, abnormal AB + MO2-actn2b standard conditions Fig. S2 from Gupta et al., 2012
heart increased size, abnormal AB + MO2-actn2b standard conditions Fig. 5 from Gupta et al., 2012
atrium lacks parts or has fewer parts of type cardiac muscle cell sarcomere, abnormal AB + MO2-actn2b standard conditions Fig. 8 from Gupta et al., 2012
atrium lacks parts or has fewer parts of type cardiac muscle cell Z disc, abnormal AB + MO2-actn2b standard conditions Fig. 8 from Gupta et al., 2012
eye decreased size, abnormal AB + MO2-actn2b standard conditions Fig. 5 from Gupta et al., 2012
whole organism refractivity, abnormal AB + MO2-actn2b standard conditions Fig. 5 from Gupta et al., 2012
cardiac muscle myofibril disorganized, abnormal AB + MO2-actn2b standard conditions Fig. 8 from Gupta et al., 2012
slow muscle cell decreased diameter, abnormal AB + MO2-actn2b standard conditions Fig. 7 from Gupta et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.