Morpholino
MO1-twist1a
- ID
- ZDB-MRPHLNO-120523-1
- Name
- MO1-twist1a
- Previous Names
- None
- Target
- Sequence
-
5' - ACCTCTGGAAAAGCTCAGATTGCGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-twist1a
No data available
Phenotype
Phenotype resulting from MO1-twist1a
No data available
Phenotype of all Fish created by or utilizing MO1-twist1a
from 1 - 3 of 3
Citations
- Murayama, E., Vivier, C., Schmidt, A., Herbomel, P. (2023) Alcam-a and Pdgfr-α are essential for the development of sclerotome-derived stromal cells that support hematopoiesis. Nature communications. 14:11711171
- Mahmoud, M., Kim, H.R., Xing, R., Hsiao, S., Mammmoto, A., Chen, J., Serbanovic-Canic, J., Feng, S., Bowden, N.P., Maguire, R., Ariaans, M., Francis, S., Weinberg, P.D., Van der Heiden, K., Jones, E.A., Chico, T.J., Ridger, V.C., Evans, P.C. (2016) TWIST1 Integrates Endothelial Responses to Flow in Vascular Dysfunction and Atherosclerosis. Circulation research. 119(3):450-62
- Das, A., and Crump, J.G. (2012) Bmps and id2a act upstream of twist1 to restrict ectomesenchyme potential of the cranial neural crest. PLoS Genetics. 8(5):e1002710
1 - 3 of 3
Show