Morpholino
MO7-cep290
- ID
- ZDB-MRPHLNO-120426-4
- Name
- MO7-cep290
- Previous Names
- None
- Target
- Sequence
-
5' - TTGATGTGTACCAGTTGTGCTGATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO7-cep290
No data available
Phenotype
Phenotype resulting from MO7-cep290
1 - 5 of 22 Show all
Phenotype of all Fish created by or utilizing MO7-cep290
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| otolith amount, abnormal | AB/TU + MO7-cep290 | control |
Fig. S1
from Cardenas-Rodriguez et al., 2021 |
| whole organism cep290 expression absent, abnormal | AB/TU + MO7-cep290 | control |
Fig. 1. 
from Cardenas-Rodriguez et al., 2021 |
| axis curved, abnormal | AB/TU + MO7-cep290 | control |
Fig. 1.
from Cardenas-Rodriguez et al., 2021 |
| photoreceptor outer segment layer decreased length, abnormal | AB/TU + MO7-cep290 | control |
Fig. 3. ,
Fig. 7.
from Cardenas-Rodriguez et al., 2021 |
| retina layer formation disrupted, abnormal | AB/TU + MO7-cep290 | control |
Fig. 2.
from Cardenas-Rodriguez et al., 2021 |
1 - 5 of 23 Show all
Citations
- Cardenas-Rodriguez, M., Austin-Tse, C., Bergboer, J.G.M., Molinari, E., Sugano, Y., Bachmann-Gagescu, R., Sayer, J.A., Drummond, I.A. (2021) Genetic compensation for cilia defects in cep290/NPHP6 mutants by upregulation of cilia-associated small GTPases. Journal of Cell Science. 134(14):
- Baye, L.M., Patrinostro, X., Swaminathan, S., Beck, J.S., Zhang, Y., Stone, E.M., Sheffield, V.C., and Slusarski, D.C. (2011) The N-terminal region of centrosomal protein 290 (CEP290) restores vision in a zebrafish model of human blindness. Human molecular genetics. 20(8):1467-77
1 - 2 of 2
Show