Morpholino
MO2-pls3
- ID
- ZDB-MRPHLNO-120424-8
- Name
- MO2-pls3
- Previous Names
- None
- Target
- Sequence
-
5' - ATATCTTACCAGCCATCTCCCAAAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pls3
No data available
Phenotype
Phenotype resulting from MO2-pls3
1 - 5 of 33 Show all
Phenotype of all Fish created by or utilizing MO2-pls3
1 - 5 of 34 Show all
Citations
- Zhong, W., Neugebauer, J., Pathak, J.L., Li, X., Pals, G., Zillikens, M.C., Eekhoff, E.M.W., Bravenboer, N., Zhang, Q., Hammerschmidt, M., Wirth, B., Micha, D. (2024) Functional Insights in PLS3-Mediated Osteogenic Regulation. Cells. 13(17):
- Fédou, C., Camus, M., Lescat, O., Feuillet, G., Mueller, I., Ross, B., Buléon, M., Neau, E., Alves, M., Goudounéche, D., Breuil, B., Boizard, F., Bardou, Q., Casemayou, A., Tack, I., Dreux, S., Batut, J., Blader, P., Burlet-Schiltz, O., Decramer, S., Wirth, B., Klein, J., Saulnier-Blache, J.S., Buffin-Meyer, B., Schanstra, J.P. (2021) Mapping of the amniotic fluid proteome of fetuses with congenital anomalies of the kidney and urinary tract identifies Plastin 3 as a protein involved in glomerular integrity. The Journal of pathology. 254(5):575-588
- van Dijk, F.S., Zillikens, M.C., Micha, D., Riessland, M., Marcelis, C.L., de Die-Smulders, C.E., Milbradt, J., Franken, A.A., Harsevoort, A.J., Lichtenbelt, K.D., Pruijs, H.E., Rubio-Gozalbo, M.E., Zwertbroek, R., Moutaouakil, Y., Egthuijsen, J., Hammerschmidt, M., Bijman, R., Semeins, C.M., Bakker, A.D., Everts, V., Klein-Nulend, J., Campos-Obando, N., Hofman, A., te Meerman, G.J., Verkerk, A.J., Uitterlinden, A.G., Maugeri, A., Sistermans, E.A., Waisfisz, Q., Meijers-Heijboer, H., Wirth, B., Simon, M.E., and Pals, G. (2013) PLS3 mutations in X-linked osteoporosis with fractures. New. Engl. J. Med.. 369(16):1529-1536
- Hao, L.T., Wolman, M., Granato, M., and Beattie, C.E. (2012) Survival motor neuron affects plastin 3 protein levels leading to motor defects. The Journal of neuroscience : the official journal of the Society for Neuroscience. 32(15):5074-5084
1 - 4 of 4
Show