Morpholino
MO1-macir
- ID
- ZDB-MRPHLNO-120424-6
- Name
- MO1-macir
- Previous Names
-
- MO1-zgc:194281
- Target
- Sequence
-
5' - ACGCTCCACTGGCATCCATTTCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-macir
No data available
Phenotype
Phenotype resulting from MO1-macir
Phenotype | Fish | Figures |
---|---|---|
Kupffer's vesicle morphology, abnormal | WT + MO1-macir |
Fig. 6
from Wright et al., 2011 |
whole organism curved ventral, abnormal | WT + MO1-macir |
Fig. 6
from Wright et al., 2011 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-macir
1 - 5 of 5
Citations
- Dorris, E.R., Tazzyman, S.J., Moylett, J., Ramamoorthi, N., Hackney, J., Townsend, M., Muthana, M., Lewis, M.J., Pitzalis, C., Wilson, A.G. (2019) The Autoimmune Susceptibility Gene C5orf30 Regulates Macrophage-Mediated Resolution of Inflammation. Journal of immunology (Baltimore, Md. : 1950). 202(4):1069-1078
- Wright, K.J., Baye, L.M., Olivier-Mason, A., Mukhopadhyay, S., Sang, L., Kwong, M., Wang, W., Pretorius, P.R., Sheffield, V.C., Sengupta, P., Slusarski, D.C., and Jackson, P.K. (2011) An ARL3-UNC119-RP2 GTPase cycle targets myristoylated NPHP3 to the primary cilium. Genes & Development. 25(22):2347-2360
1 - 2 of 2
Show