Morpholino
MO1-kmt5b
- ID
- ZDB-MRPHLNO-120424-3
- Name
- MO1-kmt5b
- Previous Names
-
- MO1-suv420h1
- Target
- Sequence
-
5' - ACCATGTTCTTGGATTCTCCCATCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kmt5b
No data available
Phenotype
Phenotype resulting from MO1-kmt5b
No data available
Phenotype of all Fish created by or utilizing MO1-kmt5b
1 - 5 of 5
Citations
- Zhao, S., Mo, G., Wang, Q., Xu, J., Yu, S., Huang, Z., Liu, W., Zhang, W. (2024) Role of RB1 in neurodegenerative diseases: inhibition of post-mitotic neuronal apoptosis via Kmt5b. Cell death discovery. 10:182182
- Huang, H.T., Kathrein, K.L., Barton, A., Gitlin, Z., Huang, Y.H., Ward, T.P., Hofmann, O., Dibiase, A., Song, A., Tyekucheva, S., Hide, W., Zhou, Y., and Zon, L.I. (2013) A network of epigenetic regulators guides developmental haematopoiesis in vivo. Nature cell biology. 15(12):1516-1525
- Kuo, A.J., Song, J., Cheung, P., Ishibe-Murakami, S., Yamazoe, S., Chen, J.K., Patel, D.J., and Gozani, O. (2012) The BAH domain of ORC1 links H4K20me2 to DNA replication licensing and Meier-Gorlin syndrome. Nature. 484(7392):115-119
1 - 3 of 3
Show