Morpholino
MO1-orc1
- ID
- ZDB-MRPHLNO-120424-1
- Name
- MO1-orc1
- Previous Names
-
- Orc1-ATG (1)
- Target
- Sequence
-
5' - TCAGTCTTGTGATGTAGCGGCTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-orc1
No data available
Phenotype
Phenotype resulting from MO1-orc1
1 - 5 of 18 Show all
Phenotype of all Fish created by or utilizing MO1-orc1
1 - 5 of 22 Show all
Citations
- Maerz, L.D., Casar Tena, T., Gerhards, J., Donow, C., Jeggo, P.A., Philipp, M. (2019) Analysis of cilia dysfunction phenotypes in zebrafish embryos depleted of Origin recognition complex factors. European journal of human genetics : EJHG. 27(5):772-782
- Huang, H.T., Kathrein, K.L., Barton, A., Gitlin, Z., Huang, Y.H., Ward, T.P., Hofmann, O., Dibiase, A., Song, A., Tyekucheva, S., Hide, W., Zhou, Y., and Zon, L.I. (2013) A network of epigenetic regulators guides developmental haematopoiesis in vivo. Nature cell biology. 15(12):1516-1525
- Kuo, A.J., Song, J., Cheung, P., Ishibe-Murakami, S., Yamazoe, S., Chen, J.K., Patel, D.J., and Gozani, O. (2012) The BAH domain of ORC1 links H4K20me2 to DNA replication licensing and Meier-Gorlin syndrome. Nature. 484(7392):115-119
- Bicknell, L.S., Walker, S., Klingseisen, A., Stiff, T., Leitch, A., Kerzendorfer, C., Martin, C.A., Yeyati, P., Al Sanna, N., Bober, M., Johnson, D., Wise, C., Jackson, A.P., O'Driscoll, M., and Jeggo, P.A. (2011) Mutations in ORC1, encoding the largest subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin syndrome. Nature Genetics. 43(4):350-5
1 - 4 of 4
Show