Morpholino

MO1-syf2

ID
ZDB-MRPHLNO-120402-1
Name
MO1-syf2
Previous Names
None
Target
Sequence
5' - TCGCTAGACGCCATGTTGCTTTTCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-syf2
Expressed Gene Anatomy Figures
elavl3 Fig. S6 with image from Chen et al., 2012
Phenotype
Phenotype resulting from MO1-syf2
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO1-syf2 Fig. 6 with image from Chen et al., 2012
blood vessel decreased amount, abnormal y1Tg + MO1-syf2 Fig. S6 with image from Chen et al., 2012
extension decreased size, abnormal WT + MO1-syf2 Fig. 6 with image from Chen et al., 2012
hatching disrupted, abnormal WT + MO1-syf2 Fig. 6 with image from Chen et al., 2012
head decreased size, abnormal WT + MO1-syf2 Fig. 6 with image from Chen et al., 2012
neurogenesis disrupted, abnormal WT + MO1-syf2 Fig. 6 with image,  Fig. S6 with image from Chen et al., 2012
neuron decreased amount, abnormal WT + MO1-syf2 Fig. 6 with image,  Fig. S6 with image from Chen et al., 2012
post-vent region increased curvature, abnormal WT + MO1-syf2 Fig. 6 with image from Chen et al., 2012
trunk bent, abnormal WT + MO1-syf2 Fig. 6 with image from Chen et al., 2012
vasculogenesis disrupted, abnormal y1Tg + MO1-syf2 Fig. S6 with image from Chen et al., 2012
whole organism apoptotic, abnormal WT + MO1-syf2 Fig. 6 with image from Chen et al., 2012
whole organism viability, abnormal WT + MO1-syf2 Fig. 6 with image from Chen et al., 2012
Phenotype of all Fish created by or utilizing MO1-syf2
Phenotype Fish Conditions Figures
apoptotic process increased occurrence, abnormal WT + MO1-syf2 standard conditions Fig. 6 with image from Chen et al., 2012
head decreased size, abnormal WT + MO1-syf2 standard conditions Fig. 6 with image from Chen et al., 2012
hatching disrupted, abnormal WT + MO1-syf2 standard conditions Fig. 6 with image from Chen et al., 2012
neurogenesis disrupted, abnormal WT + MO1-syf2 standard conditions Fig. 6 with image,  Fig. S6 with image from Chen et al., 2012
neuron decreased amount, abnormal WT + MO1-syf2 standard conditions Fig. 6 with image,  Fig. S6 with image from Chen et al., 2012
whole organism viability, abnormal WT + MO1-syf2 standard conditions Fig. 6 with image from Chen et al., 2012
trunk bent, abnormal WT + MO1-syf2 standard conditions Fig. 6 with image from Chen et al., 2012
post-vent region increased curvature, abnormal WT + MO1-syf2 standard conditions Fig. 6 with image from Chen et al., 2012
extension decreased size, abnormal WT + MO1-syf2 standard conditions Fig. 6 with image from Chen et al., 2012
whole organism apoptotic, abnormal WT + MO1-syf2 standard conditions Fig. 6 with image from Chen et al., 2012
blood vessel decreased amount, abnormal y1Tg + MO1-syf2 standard conditions Fig. S6 with image from Chen et al., 2012
vasculogenesis disrupted, abnormal y1Tg + MO1-syf2 standard conditions Fig. S6 with image from Chen et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.