Morpholino
MO3-clmpa
- ID
- ZDB-MRPHLNO-120320-9
- Name
- MO3-clmpa
- Previous Names
- None
- Target
- Sequence
-
5' - GGCACACACCAGCACTCACCACTTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking morpholino.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-clmpa
No data available
Phenotype
Phenotype resulting from MO3-clmpa
1 - 5 of 18 Show all
Phenotype of all Fish created by or utilizing MO3-clmpa
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
whole organism acta2 expression decreased amount, abnormal | AB + MO3-clmpa | control |
Fig. 4 ![]() |
post-vent region curled, abnormal | AB + MO3-clmpa | control |
Fig. 4 ![]() |
intestine peristalsis decreased process quality, abnormal | AB + MO3-clmpa | control |
Fig. 3 ![]() |
posterior intestine decreased length, abnormal | AB + MO3-clmpa | control |
Fig. 2 ![]() |
whole organism clmpa expression decreased amount, abnormal | AB + MO3-clmpa | control |
Fig. 2 ![]() ![]() |
1 - 5 of 19 Show all
Citations
- Chen, S., Xu, J., Xiao, Y., Cai, H., Zhou, J., Cai, W., Wang, Y. (2025) Loss-of-Function of CLMP Is Associated With Congenital Short Bowel Syndrome and Impaired Intestinal Development. Clinical genetics. :
- Werf, C.S., Wabbersen, T.D., Hsiao, N.H., Paredes, J., Etchevers, H.C., Kroisel, P.M., Tibboel, D., Babarit, C., Schreiber, R.A., Hoffenberg, E.J., Vekemans, M., Zeder, S.L., Ceccherini, I., Lyonnet, S., Ribeiro, A.S., Seruca, R., Te Meerman, G.J., van Ijzendoorn, S.C., Shepherd, I.T., Verheij, J.B., and Hofstra, R.M. (2012) CLMP Is Required for Intestinal Development, and Loss-of-Function Mutations Cause Congenital Short-Bowel Syndrome. Gastroenterology. 142(3):453-462
1 - 2 of 2
Show