Morpholino
MO3-bmp2a
- ID
- ZDB-MRPHLNO-120314-4
- Name
- MO3-bmp2a
- Previous Names
- None
- Target
- Sequence
-
5' - AGTAAACACTTGCTTACCATCATGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-bmp2a
No data available
Phenotype
Phenotype resulting from MO3-bmp2a
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO3-bmp2a
1 - 4 of 4
Citations
- Mao, A., Zhang, M., Li, L., Liu, J., Ning, G., Cao, Y., Wang, Q. (2020) Pharyngeal pouches provide a niche microenvironment for arch artery progenitor specification. Development (Cambridge, England). 148(2):
- Manfroid, I., Ghaye, A., Naye, F., Detry, N., Palm, S., Pan, L., Ma, T.P., Huang, W., Rovira, M., Martial, J.A., Parsons, M.J., Moens, C.B., Voz, M.L., and Peers, B. (2012) Zebrafish sox9b is crucial for hepatopancreatic duct development and pancreatic endocrine cell regeneration. Developmental Biology. 366(2):268-278
- Naye, F., Voz, M.L., Detry, N., Hammerschmidt, M., Peers, B., and Manfroid, I. (2012) Essential roles of zebrafish bmp2a, fgf10 and fgf24 in the specification of the ventral pancreas. Molecular biology of the cell. 23(5):945-954
1 - 3 of 3
Show