Morpholino
MO2-grhl2a
- ID
- ZDB-MRPHLNO-120207-6
- Name
- MO2-grhl2a
- Previous Names
-
- ATG-blocking MO (1)
- Target
- Sequence
-
5' - CTTATTCTCCTCCTGAGCCATGTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-grhl2a
No data available
Phenotype
Phenotype resulting from MO2-grhl2a
| Phenotype | Fish | Figures |
|---|---|---|
| trunk increased width, abnormal | WT + MO2-grhl2a |
Fig. S6 |
| trunk shortened, abnormal | WT + MO2-grhl2a |
Fig. S6 |
Phenotype of all Fish created by or utilizing MO2-grhl2a
Citations