Morpholino
MO1-glrx2
- ID
- ZDB-MRPHLNO-120127-9
- Name
- MO1-glrx2
- Previous Names
- None
- Target
- Sequence
-
5' - GTTGAAGATACTAGGAAAGCAAACG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-glrx2
No data available
Phenotype
Phenotype resulting from MO1-glrx2
1 - 5 of 31 Show all
Phenotype of all Fish created by or utilizing MO1-glrx2
1 - 5 of 32 Show all
Citations
- Wilms, C., Lepka, K., Häberlein, F., Edwards, S., Felsberg, J., Pudelko, L., Lindenberg, T.T., Poschmann, G., Qin, N., Volbracht, K., Prozorovski, T., Meuth, S.G., Kahlert, U.D., Remke, M., Aktas, O., Reifenberger, G., Bräutigam, L., Odermatt, B., Berndt, C. (2021) Glutaredoxin 2 promotes SP-1-dependent CSPG4 transcription and migration of wound healing NG2 glia and glioma cells: Enzymatic Taoism. Redox Biology. 49:102221
- Berndt, C., Poschmann, G., Stühler, K., Holmgren, A., Bräutigam, L. (2014) Zebrafish heart development is regulated via glutaredoxin 2 dependent migration and survival of neural crest cells. Redox Biology. 2:673-8
- Bräutigam, L., Jensen, L.D., Poschmann, G., Nyström, S., Bannenberg, S., Dreij, K., Lepka, K., Prozorovski, T., Montano, S.J., Aktas, O., Uhlén, P., Stühler, K., Cao, Y., Holmgren, A., and Berndt, C. (2013) Glutaredoxin regulates vascular development by reversible glutathionylation of sirtuin 1. Proceedings of the National Academy of Sciences of the United States of America. 110(50):20057-20062
- Bräutigam, L., Schütte, L.D., Godoy, J.R., Prozorovski, T., Gellert, M., Hauptmann, G., Holmgren, A., Lillig, C.H., and Berndt, C. (2011) Vertebrate-specific glutaredoxin is essential for brain development. Proceedings of the National Academy of Sciences of the United States of America. 108(51):20532-7
1 - 4 of 4
Show