Morpholino

MO1-rbm24a

ID
ZDB-MRPHLNO-120111-1
Name
MO1-rbm24a
Previous Names
None
Target
Sequence
5' - TGCATCCTCACGAAACGCTCAAGTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rbm24a
No data available
Phenotype
Phenotype resulting from MO1-rbm24a
Phenotype Fish Figures
angiogenesis disrupted, abnormal zn1Tg + MO1-rbm24a Fig. 5 with image from Maragh et al., 2011
blood circulation decreased rate, abnormal WT + MO1-rbm24a Fig. 2 with image from Maragh et al., 2011
caudal vein absent, abnormal zn1Tg + MO1-rbm24a Fig. 5 with image from Maragh et al., 2011
chondrocranium cartilage aplastic, abnormal WT + MO1-rbm24a Fig. S1 with image from Maragh et al., 2014
dorsal aorta absent, abnormal zn1Tg + MO1-rbm24a Fig. 5 with image from Maragh et al., 2011
ethmoid cartilage absent, abnormal WT + MO1-rbm24a Fig. S1 with image from Maragh et al., 2014
eye decreased size, abnormal WT + MO1-rbm24a Fig. S1 with image from Maragh et al., 2014
head decreased size, abnormal WT + MO1-rbm24a Fig. S1 with image from Maragh et al., 2014
head muscle malformed, abnormal WT + MO1-rbm24a Fig. S1 with image from Maragh et al., 2014
heart edematous, abnormal WT + MO1-rbm24a Fig. 2 with imageFig. 5 with imageFig. 6 with image from Maragh et al., 2011
heart contraction decreased rate, abnormal AB + MO1-rbm24a Fig. 4 with image from Maragh et al., 2011
heart looping disrupted, abnormal WT + MO1-rbm24a Fig. 2 with imageFig. 5 with image from Maragh et al., 2011
hyosymplectic cartilage absent, abnormal WT + MO1-rbm24a Fig. S1 with image from Maragh et al., 2014
Meckel's cartilage absent, abnormal WT + MO1-rbm24a Fig. S1 with image from Maragh et al., 2014
mRNA processing process quality, abnormal WT + MO1-rbm24a Fig. 4 with image from Maragh et al., 2014
palatoquadrate cartilage absent, abnormal WT + MO1-rbm24a Fig. S1 with image from Maragh et al., 2014
posterior cardinal vein increased thickness, abnormal zn1Tg + MO1-rbm24a Fig. 5 with image from Maragh et al., 2011
skeletal muscle cell disorganized, abnormal WT + MO1-rbm24a Fig. 2 with image from Maragh et al., 2014
skeletal muscle cell loose, abnormal WT + MO1-rbm24a Fig. 2 with image from Maragh et al., 2014
somite decreased amount, abnormal WT + MO1-rbm24a Fig. 2 with image from Maragh et al., 2014
somite malformed, abnormal WT + MO1-rbm24a Fig. 2 with image from Maragh et al., 2014
somite morphology, abnormal WT + MO1-rbm24a Fig. 2 with image from Maragh et al., 2014
somite shape, abnormal WT + MO1-rbm24a Fig. 2 with image from Maragh et al., 2014
somite spatial pattern, abnormal WT + MO1-rbm24a Fig. 2 with image from Maragh et al., 2014
trunk vasculature disorganized, abnormal zn1Tg + MO1-rbm24a Fig. 5 with image from Maragh et al., 2011
trunk vasculature hypoplastic, abnormal zn1Tg + MO1-rbm24a Fig. 5 with image from Maragh et al., 2011
Phenotype of all Fish created by or utilizing MO1-rbm24a
Phenotype Fish Conditions Figures
heart contraction decreased rate, abnormal AB + MO1-rbm24a standard conditions Fig. 4 with image from Maragh et al., 2011
heart edematous, abnormal AB + MO1-rbm24a standard conditions Fig. 6 with image from Maragh et al., 2011
chondrocranium cartilage aplastic, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
heart edematous, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2011
skeletal muscle cell disorganized, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
head muscle malformed, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
palatoquadrate cartilage absent, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
mRNA processing process quality, abnormal WT + MO1-rbm24a standard conditions Fig. 4 with image from Maragh et al., 2014
head decreased size, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
ethmoid cartilage absent, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
somite shape, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
somite malformed, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
somite morphology, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
heart looping disrupted, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2011
eye decreased size, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
hyosymplectic cartilage absent, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
Meckel's cartilage absent, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
blood circulation decreased rate, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2011
somite decreased amount, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
skeletal muscle cell loose, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
somite spatial pattern, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
dorsal aorta absent, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
posterior cardinal vein increased thickness, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
heart looping disrupted, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
caudal vein absent, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
trunk vasculature disorganized, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
trunk vasculature hypoplastic, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
heart edematous, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
angiogenesis disrupted, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
blood circulation disrupted, abnormal AB + MO1-rbm24a + MO1-rbm24b standard conditions Fig. 6 with image from Maragh et al., 2011
heart tube unstructured, abnormal AB + MO1-rbm24a + MO1-rbm24b standard conditions Fig. 6 with image from Maragh et al., 2011
heart edematous, abnormal AB + MO1-rbm24a + MO1-rbm24b standard conditions Fig. 6 with image from Maragh et al., 2011
heart deformed, abnormal AB + MO1-rbm24a + MO1-rbm24b standard conditions Fig. 6 with image from Maragh et al., 2011
Citations