Morpholino

MO1-rbm24a

ID
ZDB-MRPHLNO-120111-1
Name
MO1-rbm24a
Previous Names
None
Target
Sequence
5' - TGCATCCTCACGAAACGCTCAAGTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rbm24a
Expressed Gene Anatomy Figures
dlc Fig. 3 with image from Maragh et al., 2014
dld Fig. 3 with image from Maragh et al., 2014
her1 Fig. 3 with image from Maragh et al., 2014
her7 Fig. 3 with image from Maragh et al., 2014
myh6 Fig. 4 with image from Maragh et al., 2011
myh7 Fig. 4 with image from Maragh et al., 2011
myl7 Fig. 4 with image from Maragh et al., 2011
myod1 Fig. 2 with image,  Fig. S1 with image from Maragh et al., 2014
notch1a Fig. S2 with image from Maragh et al., 2014
notch3 Fig. S2 with image from Maragh et al., 2014
tbx16 Fig. 3 with image from Maragh et al., 2014
Phenotype
Phenotype resulting from MO1-rbm24a
Phenotype Fish Figures
angiogenesis disrupted, abnormal zn1Tg + MO1-rbm24a Fig. 5 with image from Maragh et al., 2011
blood circulation decreased rate, abnormal WT + MO1-rbm24a Fig. 2 with image from Maragh et al., 2011
caudal vein absent, abnormal zn1Tg + MO1-rbm24a Fig. 5 with image from Maragh et al., 2011
chondrocranium cartilage aplastic, abnormal WT + MO1-rbm24a Fig. S1 with image from Maragh et al., 2014
dorsal aorta absent, abnormal zn1Tg + MO1-rbm24a Fig. 5 with image from Maragh et al., 2011
ethmoid cartilage absent, abnormal WT + MO1-rbm24a Fig. S1 with image from Maragh et al., 2014
eye decreased size, abnormal WT + MO1-rbm24a Fig. S1 with image from Maragh et al., 2014
head decreased size, abnormal WT + MO1-rbm24a Fig. S1 with image from Maragh et al., 2014
head muscle malformed, abnormal WT + MO1-rbm24a Fig. S1 with image from Maragh et al., 2014
heart edematous, abnormal WT + MO1-rbm24a Fig. 2 with image,  Fig. 5 with image,  Fig. 6 with image from Maragh et al., 2011
heart contraction decreased rate, abnormal AB + MO1-rbm24a Fig. 4 with image from Maragh et al., 2011
heart looping disrupted, abnormal WT + MO1-rbm24a Fig. 2 with image,  Fig. 5 with image from Maragh et al., 2011
hyosymplectic cartilage absent, abnormal WT + MO1-rbm24a Fig. S1 with image from Maragh et al., 2014
Meckel's cartilage absent, abnormal WT + MO1-rbm24a Fig. S1 with image from Maragh et al., 2014
mRNA processing process quality, abnormal WT + MO1-rbm24a Fig. 4 with image from Maragh et al., 2014
palatoquadrate cartilage absent, abnormal WT + MO1-rbm24a Fig. S1 with image from Maragh et al., 2014
posterior cardinal vein increased thickness, abnormal zn1Tg + MO1-rbm24a Fig. 5 with image from Maragh et al., 2011
skeletal muscle cell disorganized, abnormal WT + MO1-rbm24a Fig. 2 with image from Maragh et al., 2014
skeletal muscle cell loose, abnormal WT + MO1-rbm24a Fig. 2 with image from Maragh et al., 2014
somite decreased amount, abnormal WT + MO1-rbm24a Fig. 2 with image from Maragh et al., 2014
somite malformed, abnormal WT + MO1-rbm24a Fig. 2 with image from Maragh et al., 2014
somite morphology, abnormal WT + MO1-rbm24a Fig. 2 with image from Maragh et al., 2014
somite shape, abnormal WT + MO1-rbm24a Fig. 2 with image from Maragh et al., 2014
somite spatial pattern, abnormal WT + MO1-rbm24a Fig. 2 with image from Maragh et al., 2014
trunk vasculature disorganized, abnormal zn1Tg + MO1-rbm24a Fig. 5 with image from Maragh et al., 2011
trunk vasculature hypoplastic, abnormal zn1Tg + MO1-rbm24a Fig. 5 with image from Maragh et al., 2011
Phenotype of all Fish created by or utilizing MO1-rbm24a
Phenotype Fish Conditions Figures
heart contraction decreased rate, abnormal AB + MO1-rbm24a standard conditions Fig. 4 with image from Maragh et al., 2011
heart edematous, abnormal AB + MO1-rbm24a standard conditions Fig. 6 with image from Maragh et al., 2011
chondrocranium cartilage aplastic, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
heart edematous, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2011
skeletal muscle cell disorganized, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
head muscle malformed, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
palatoquadrate cartilage absent, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
mRNA processing process quality, abnormal WT + MO1-rbm24a standard conditions Fig. 4 with image from Maragh et al., 2014
head decreased size, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
ethmoid cartilage absent, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
somite shape, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
somite malformed, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
somite morphology, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
heart looping disrupted, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2011
eye decreased size, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
hyosymplectic cartilage absent, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
Meckel's cartilage absent, abnormal WT + MO1-rbm24a standard conditions Fig. S1 with image from Maragh et al., 2014
blood circulation decreased rate, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2011
somite decreased amount, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
skeletal muscle cell loose, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
somite spatial pattern, abnormal WT + MO1-rbm24a standard conditions Fig. 2 with image from Maragh et al., 2014
dorsal aorta absent, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
posterior cardinal vein increased thickness, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
heart looping disrupted, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
caudal vein absent, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
trunk vasculature disorganized, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
trunk vasculature hypoplastic, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
heart edematous, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
angiogenesis disrupted, abnormal zn1Tg + MO1-rbm24a standard conditions Fig. 5 with image from Maragh et al., 2011
blood circulation disrupted, abnormal AB + MO1-rbm24a + MO1-rbm24b standard conditions Fig. 6 with image from Maragh et al., 2011
heart tube unstructured, abnormal AB + MO1-rbm24a + MO1-rbm24b standard conditions Fig. 6 with image from Maragh et al., 2011
heart edematous, abnormal AB + MO1-rbm24a + MO1-rbm24b standard conditions Fig. 6 with image from Maragh et al., 2011
heart deformed, abnormal AB + MO1-rbm24a + MO1-rbm24b standard conditions Fig. 6 with image from Maragh et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.