Morpholino
MO6-spi1b
- ID
- ZDB-MRPHLNO-111212-4
- Name
- MO6-spi1b
- Previous Names
-
- MO6-spi1
- Target
- Sequence
-
5' - AATAACTGATACAAACTCACCGTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-spi1b
No data available
Phenotype
Phenotype resulting from MO6-spi1b
Phenotype | Fish | Figures |
---|---|---|
myeloid cell decreased amount, abnormal | WT + MO6-spi1b |
Fig. 6
from Li et al., 2011 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO6-spi1b
1 - 5 of 7 Show all
Citations
- Yu, T., Kuang, H., Wu, X., Huang, Y., Wang, J., Wen, Z. (2023) Cell competition for neuron-derived trophic factor controls the turnover and lifespan of microglia. Science advances. 9:eadf9790
- Deng, Y., Wang, H., Liu, X., Yuan, H., Xu, J., de Thé, H., Zhou, J., Zhu, J. (2022) Zbtb14 regulates monocyte and macrophage development through inhibiting pu.1 expression in zebrafish. eLIFE. 11:
- Wu, S., Xue, R., Hassan, S., Nguyen, T.M.L., Wang, T., Pan, H., Xu, J., Liu, Q., Zhang, W., Wen, Z. (2018) Il34-Csf1r Pathway Regulates the Migration and Colonization of Microglial Precursors. Developmental Cell. 46:552-563.e4
- Jin, H., Li, L., Xu, J., Zhen, F., Zhu, L., Liu, P.P., Zhang, M., Zhang, W., and Wen, Z. (2012) Runx1 regulates embryonic myeloid fate choice in zebrafish through a negative feedback loop inhibiting Pu.1 expression. Blood. 119(22):5239-5249
- Li, L., Jin, H., Xu, J., Shi, Y., and Wen, Z. (2011) Irf8 regulates macrophage versus neutrophil fate during zebrafish primitive myelopoiesis. Blood. 117(4):1359-1369
1 - 5 of 5
Show