Morpholino

MO2-def6a

ID
ZDB-MRPHLNO-111207-3
Name
MO2-def6a
Previous Names
  • def6 splice MO (1)
Target
Sequence
5' - AAAGAGAGCATACCTTGTCCAGGAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO (exon2/intron2 boundary).
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-def6a
Expressed Gene Anatomy Figures
bmp2b Fig. 4 with image from Goudevenou et al., 2011
bmp4 Fig. 4 with image from Goudevenou et al., 2011
cdx4 Fig. 4 with image from Goudevenou et al., 2011
chrd Fig. 4 with image from Goudevenou et al., 2011
ctslb Fig. 5 with image from Goudevenou et al., 2011
dlx3b Fig. 5 with image from Goudevenou et al., 2011
egr2b Fig. 4 with image from Goudevenou et al., 2011
gsc Fig. 4 with image from Goudevenou et al., 2011
myod1 Fig. 5 with image from Goudevenou et al., 2011
pax2a Fig. 4 with image from Goudevenou et al., 2011
tbxta Fig. 4 with image,  Fig. 5 with image from Goudevenou et al., 2011
Phenotype
Phenotype resulting from MO2-def6a
Phenotype Fish Figures
axis decreased length, abnormal WT + MO2-def6a Fig. 2 with image,  Fig. 3 with image,  Fig. 6 with image,  Fig. 9 with image,  Fig. S2 with image from Goudevenou et al., 2011
axis elongation disrupted, abnormal WT + MO2-def6a Fig. 2 with image from Goudevenou et al., 2011
brain morphology, abnormal WT + MO2-def6a Fig. 6 with image,  Fig. 9 with image,  Fig. S2 with image from Goudevenou et al., 2011
cell migration involved in gastrulation disrupted, abnormal WT + MO2-def6a Fig. 2 with image,  Fig. 6 with image,  Fig. 9 with image from Goudevenou et al., 2011
cell migration involved in mesendoderm migration disrupted, abnormal WT + MO2-def6a Fig. 4 with image from Goudevenou et al., 2011
ceratohyal cartilage mislocalised posteriorly, abnormal WT + MO2-def6a Fig. 7 with image from Goudevenou et al., 2011
convergent extension involved in axis elongation disrupted, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
convergent extension involved in neural plate elongation disrupted, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
eye decreased distance eye, abnormal WT + MO2-def6a Fig. 9 with image from Goudevenou et al., 2011
eye increased distance eye, abnormal WT + MO2-def6a Fig. 7 with image from Goudevenou et al., 2011
forebrain structure, abnormal WT + MO2-def6a Fig. 9 with image from Goudevenou et al., 2011
head anterior region flattened, abnormal WT + MO2-def6a Fig. 7 with image from Goudevenou et al., 2011
hindbrain neural keel increased width, abnormal WT + MO2-def6a Fig. 4 with image from Goudevenou et al., 2011
Meckel's cartilage decreased length, abnormal WT + MO2-def6a Fig. 7 with image from Goudevenou et al., 2011
Meckel's cartilage shape, abnormal WT + MO2-def6a Fig. 7 with image from Goudevenou et al., 2011
midbrain hindbrain boundary neural keel increased width, abnormal WT + MO2-def6a Fig. 4 with image from Goudevenou et al., 2011
neural plate increased width, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
notochord decreased length, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
notochord increased width, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
notochord undulate, abnormal WT + MO2-def6a Fig. 5 with image,  Fig. S2 with image from Goudevenou et al., 2011
paraxial mesoderm adaxial cell increased distance paraxial mesoderm adaxial cell, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
paraxial mesoderm formation disrupted, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
pericardium edematous, abnormal WT + MO2-def6a Fig. S2 with image from Goudevenou et al., 2011
polster mislocalised posteriorly, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
segmental plate curved, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
segmental plate increased width, abnormal WT + MO2-def6a Fig. 5 with image from Goudevenou et al., 2011
somite morphology, abnormal WT + MO2-def6a Fig. 5 with image,  Fig. 6 with image,  Fig. S2 with image from Goudevenou et al., 2011
tail bud truncated, abnormal WT + MO2-def6a Fig. 6 with image,  Fig. S2 with image from Goudevenou et al., 2011
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-def6a Fig. 2 with image,  Fig. 6 with image,  Fig. S2 with image from Goudevenou et al., 2011
Phenotype of all Fish created by or utilizing MO2-def6a
Phenotype Fish Conditions Figures
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-def6a standard conditions Fig. 2 with image,  Fig. 6 with image,  Fig. S2 with image from Goudevenou et al., 2011
paraxial mesoderm formation disrupted, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
convergent extension involved in axis elongation disrupted, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
cell migration involved in gastrulation disrupted, abnormal WT + MO2-def6a standard conditions Fig. 2 with image,  Fig. 6 with image,  Fig. 9 with image from Goudevenou et al., 2011
neural plate increased width, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
segmental plate curved, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
segmental plate increased width, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
eye decreased distance eye, abnormal WT + MO2-def6a standard conditions Fig. 9 with image from Goudevenou et al., 2011
hindbrain neural keel increased width, abnormal WT + MO2-def6a standard conditions Fig. 4 with image from Goudevenou et al., 2011
axis decreased length, abnormal WT + MO2-def6a standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 6 with image,  Fig. 9 with image,  Fig. S2 with image from Goudevenou et al., 2011
Meckel's cartilage shape, abnormal WT + MO2-def6a standard conditions Fig. 7 with image from Goudevenou et al., 2011
axis elongation disrupted, abnormal WT + MO2-def6a standard conditions Fig. 2 with image from Goudevenou et al., 2011
forebrain structure, abnormal WT + MO2-def6a standard conditions Fig. 9 with image from Goudevenou et al., 2011
eye increased distance eye, abnormal WT + MO2-def6a standard conditions Fig. 7 with image from Goudevenou et al., 2011
polster mislocalised posteriorly, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
cell migration involved in mesendoderm migration disrupted, abnormal WT + MO2-def6a standard conditions Fig. 4 with image from Goudevenou et al., 2011
brain morphology, abnormal WT + MO2-def6a standard conditions Fig. 6 with image,  Fig. 9 with image,  Fig. S2 with image from Goudevenou et al., 2011
midbrain hindbrain boundary neural keel increased width, abnormal WT + MO2-def6a standard conditions Fig. 4 with image from Goudevenou et al., 2011
paraxial mesoderm adaxial cell increased distance paraxial mesoderm adaxial cell, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
somite morphology, abnormal WT + MO2-def6a standard conditions Fig. 5 with image,  Fig. 6 with image,  Fig. S2 with image from Goudevenou et al., 2011
tail bud truncated, abnormal WT + MO2-def6a standard conditions Fig. 6 with image,  Fig. S2 with image from Goudevenou et al., 2011
notochord decreased length, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
Meckel's cartilage decreased length, abnormal WT + MO2-def6a standard conditions Fig. 7 with image from Goudevenou et al., 2011
convergent extension involved in neural plate elongation disrupted, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
notochord increased width, abnormal WT + MO2-def6a standard conditions Fig. 5 with image from Goudevenou et al., 2011
ceratohyal cartilage mislocalised posteriorly, abnormal WT + MO2-def6a standard conditions Fig. 7 with image from Goudevenou et al., 2011
head anterior region flattened, abnormal WT + MO2-def6a standard conditions Fig. 7 with image from Goudevenou et al., 2011
pericardium edematous, abnormal WT + MO2-def6a standard conditions Fig. S2 with image from Goudevenou et al., 2011
notochord undulate, abnormal WT + MO2-def6a standard conditions Fig. 5 with image,  Fig. S2 with image from Goudevenou et al., 2011
axis decreased length, abnormal WT + MO1-wnt11f2 + MO2-def6a standard conditions Fig. 9 with image from Goudevenou et al., 2011
cell migration involved in gastrulation disrupted, abnormal WT + MO1-wnt11f2 + MO2-def6a standard conditions Fig. 9 with image from Goudevenou et al., 2011
forebrain anterior region aplastic, abnormal WT + MO1-wnt11f2 + MO2-def6a standard conditions Fig. 9 with image from Goudevenou et al., 2011
eye fused with eye, abnormal WT + MO1-wnt11f2 + MO2-def6a standard conditions Fig. 9 with image from Goudevenou et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.