Morpholino

MO1-prmt5

ID
ZDB-MRPHLNO-111103-3
Name
MO1-prmt5
Previous Names
None
Target
Sequence
5' - GACGCCATCGTTAGGAGACGAGATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-prmt5
No data available
Phenotype
Phenotype resulting from MO1-prmt5
Phenotype Fish Figures
dorsal aorta decreased size, abnormal s940Tg/s940Tg + MO1-prmt5 Fig. 3 with image from Quillien et al., 2021
dorsal aorta Venus expression spatial pattern, abnormal s940Tg/s940Tg + MO1-prmt5 Fig. 3 with image from Quillien et al., 2021
dorsal aorta intersegmental vessel GFP expression decreased amount, abnormal mu101Tg/mu101Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO1-prmt5 Fig. 5 with image from Quillien et al., 2021
dorsal aorta intersegmental vessel GFP expression spatial pattern, abnormal y1Tg/y1Tg + MO1-prmt5 Fig. 3 with image from Quillien et al., 2021
intersegmental vessel morphogenesis of a branching structure decreased process quality, abnormal y1Tg/y1Tg + MO1-prmt5 Fig. 3 with image from Quillien et al., 2021
intersegmental vessel transcription cis-regulatory region binding decreased process quality, abnormal mu101Tg/mu101Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO1-prmt5 Fig. 5 with image from Quillien et al., 2021
regulation of cell cycle disrupted, abnormal WT + MO1-prmt5 Fig. 6 with image from Batut et al., 2011
regulation of cell cycle increased occurrence, abnormal WT + MO1-prmt5 Fig. 6 with image from Batut et al., 2011
slow muscle cell decreased amount, abnormal WT + MO1-prmt5 Fig. 4 with image from Batut et al., 2011
somite elongated, abnormal WT + MO1-prmt5 Fig. 2 with image from Batut et al., 2011
somite flattened, abnormal WT + MO1-prmt5 Fig. 2 with image from Batut et al., 2011
somite lacks parts or has fewer parts of type fast muscle cell, abnormal WT + MO1-prmt5 Fig. 4 with image from Batut et al., 2011
thymus EGFP expression decreased amount, abnormal mu271Tg/mu271Tg; sd32Tg/sd32Tg + MO1-prmt5 Fig 1 with imageFig 2 with image from Quillien et al., 2021
trunk ab1-prmt5 labeling decreased amount, abnormal WT + MO1-prmt5 Fig 2 with image from Quillien et al., 2021
whole organism Ab2-sDMA labeling decreased amount, abnormal WT + MO1-prmt5 Fig 2 with image from Quillien et al., 2021
whole organism Ab1-wdr77 labeling decreased amount, abnormal WT + MO1-prmt5 Fig 2 with image from Quillien et al., 2021
whole organism ab1-prmt5 labeling decreased amount, abnormal WT + MO1-prmt5 Fig 2 with image from Quillien et al., 2021
whole organism decreased length, abnormal WT + MO1-prmt5 Fig. 2 with image from Batut et al., 2011
Phenotype of all Fish created by or utilizing MO1-prmt5
Phenotype Fish Conditions Figures
dorsal aorta decreased size, abnormal s940Tg/s940Tg + MO1-prmt5 standard conditions Fig. 3 with image from Quillien et al., 2021
dorsal aorta Venus expression spatial pattern, abnormal s940Tg/s940Tg + MO1-prmt5 standard conditions Fig. 3 with image from Quillien et al., 2021
dorsal aorta intersegmental vessel GFP expression spatial pattern, abnormal y1Tg/y1Tg + MO1-prmt5 standard conditions Fig. 3 with image from Quillien et al., 2021
intersegmental vessel morphogenesis of a branching structure decreased process quality, abnormal y1Tg/y1Tg + MO1-prmt5 standard conditions Fig. 3 with image from Quillien et al., 2021
somite elongated, abnormal WT + MO1-prmt5 standard conditions Fig. 2 with image from Batut et al., 2011
whole organism decreased length, abnormal WT + MO1-prmt5 standard conditions Fig. 2 with image from Batut et al., 2011
whole organism ab1-prmt5 labeling decreased amount, abnormal WT + MO1-prmt5 standard conditions Fig 2 with image from Quillien et al., 2021
somite lacks parts or has fewer parts of type fast muscle cell, abnormal WT + MO1-prmt5 standard conditions Fig. 4 with image from Batut et al., 2011
regulation of cell cycle disrupted, abnormal WT + MO1-prmt5 standard conditions Fig. 6 with image from Batut et al., 2011
trunk ab1-prmt5 labeling decreased amount, abnormal WT + MO1-prmt5 standard conditions Fig 2 with image from Quillien et al., 2021
somite flattened, abnormal WT + MO1-prmt5 standard conditions Fig. 2 with image from Batut et al., 2011
whole organism Ab1-wdr77 labeling decreased amount, abnormal WT + MO1-prmt5 standard conditions Fig 2 with image from Quillien et al., 2021
slow muscle cell decreased amount, abnormal WT + MO1-prmt5 standard conditions Fig. 4 with image from Batut et al., 2011
regulation of cell cycle increased occurrence, abnormal WT + MO1-prmt5 standard conditions Fig. 6 with image from Batut et al., 2011
whole organism Ab2-sDMA labeling decreased amount, abnormal WT + MO1-prmt5 standard conditions Fig 2 with image from Quillien et al., 2021
dorsal aorta intersegmental vessel GFP expression decreased amount, abnormal mu101Tg/mu101Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO1-prmt5 standard conditions Fig. 5 with image from Quillien et al., 2021
intersegmental vessel transcription cis-regulatory region binding decreased process quality, abnormal mu101Tg/mu101Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO1-prmt5 standard conditions Fig. 5 with image from Quillien et al., 2021
thymus EGFP expression decreased amount, abnormal mu271Tg/mu271Tg; sd32Tg/sd32Tg + MO1-prmt5 standard conditions Fig 1 with imageFig 2 with image from Quillien et al., 2021
Citations