Morpholino
MO3-dscama
- ID
- ZDB-MRPHLNO-111031-3
- Name
- MO3-dscama
- Previous Names
-
- MO3-dscam
- Target
- Sequence
-
5' - AAAGATCCTGAAATGCTCACCGGCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-dscama
No data available
Phenotype
Phenotype resulting from MO3-dscama
Phenotype | Fish | Figures |
---|---|---|
enteric neuron decreased amount, abnormal | AB + MO3-dscama |
FIGURE 4 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO3-dscama
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
enteric neuron decreased amount, abnormal | AB + MO3-dscama | standard conditions |
FIGURE 4 ![]() |
1 - 1 of 1
Citations
- Lu, Y.J., Yu, W.W., Cui, M.M., Yu, X.X., Song, H.L., Bai, M.R., Wu, W.J., Gu, B.L., Wang, J., Cai, W., Chu, X. (2021) Association Analysis of Variants of DSCAM and BACE2 With Hirschsprung Disease Susceptibility in Han Chinese and Functional Evaluation in Zebrafish. Frontiers in cell and developmental biology. 9:641152
- Hale, L.A., Fowler, D.K., and Eisen, J.S. (2011) Netrin Signaling Breaks the Equivalence between Two Identified Zebrafish Motoneurons Revealing a New Role of Intermediate Targets. PLoS One. 6(10):e25841
1 - 2 of 2
Show