Morpholino
MO2-npnta
- ID
- ZDB-MRPHLNO-111018-2
- Name
- MO2-npnta
- Previous Names
-
- MO2-npnt
- Target
- Sequence
-
5' - TGTGAAACGGCAGACGGAACTCACT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-npnta
No data available
Phenotype
Phenotype resulting from MO2-npnta
1 - 5 of 27 Show all
Phenotype of all Fish created by or utilizing MO2-npnta
1 - 5 of 38 Show all
Citations
- Müller-Deile, J., Sopel, N., Ohs, A., Rose, V., Gröner, M., Wrede, C., Hegermann, J., Daniel, C., Amann, K., Zahner, G., Schiffer, M. (2021) Glomerular Endothelial Cell-Derived microRNA-192 Regulates Nephronectin Expression in Idiopathic Membranous Glomerulonephritis. Journal of the American Society of Nephrology : JASN. 32:2777-2794
- Müller-Deile, J., Dannenberg, J., Schroder, P., Lin, M.H., Miner, J.H., Chen, R., Bräsen, J.H., Thum, T., Nyström, J., Staggs, L.B., Haller, H., Fiedler, J., Lorenzen, J.M., Schiffer, M. (2017) Podocytes regulate the glomerular basement membrane protein nephronectin by means of miR-378a-3p in glomerular diseases. Kidney International. 92(4):836-849
- Patra, C., Diehl, F., Ferrazzi, F., van Amerongen, M.J., Novoyatleva, T., Schaefer, L., Mühlfeld, C., Jungblut, B., and Engel, F.B. (2011) Nephronectin regulates atrioventricular canal differentiation via Bmp4-Has2 signaling in zebrafish. Development (Cambridge, England). 138(20):4499-4509
1 - 3 of 3
Show