Morpholino
MO2-tgfb3
- ID
- ZDB-MRPHLNO-110929-7
- Name
- MO2-tgfb3
- Previous Names
-
- e1i1-MO (1)
- Target
- Sequence
-
5' - CATCATCCCTAAGGGAAACTTACTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tgfb3
No data available
Phenotype
Phenotype resulting from MO2-tgfb3
1 - 5 of 16 Show all
Phenotype of all Fish created by or utilizing MO2-tgfb3
1 - 5 of 45 Show all
Citations
- Wang, L., Guan, X., Hu, Q., Wu, Z., Chen, W., Song, L., Wang, K., Tian, K., Cao, C., Zhang, D., Ma, J., Tong, X., Zhang, B., Zhang, J., Zeng, C. (2021) TGFB3 downregulation causing chordomagenesis and its tumor suppression role maintained by Smad7. Carcinogenesis. 42(7):913-923
- Monteiro, R., Pinheiro, P., Joseph, N., Peterkin, T., Koth, J., Repapi, E., Bonkhofer, F., Kirmizitas, A., Patient, R. (2016) Transforming Growth Factor β Drives Hemogenic Endothelium Programming and the Transition to Hematopoietic Stem Cells. Developmental Cell. 38(4):358-70
- Cheah, F.S., Winkler, C., Jabs, E.W., and Chong, S.S. (2010) tgfbeta3 Regulation of Chondrogenesis and Osteogenesis in Zebrafish is Mediated Through Formation and Survival of a Subpopulation of the Cranial Neural Crest. Mechanisms of Development. 128(7-8):329-344
1 - 3 of 3
Show