Morpholino
MO2-ifngr1
- ID
- ZDB-MRPHLNO-110928-15
- Name
- MO2-ifngr1
- Previous Names
-
- MO2-crfb17
- MO2-ifngr1l
- Target
- Sequence
-
5' - TTAAACTAAATCGCCTTACCTTGTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ifngr1
No data available
Phenotype
Phenotype resulting from MO2-ifngr1
| Phenotype | Fish | Figures |
|---|---|---|
| endothelial cell cell population proliferation increased rate, abnormal | la2Tg; s896Tg + MO2-ifngr1 |
Fig. S4 
from Sawamiphak et al., 2014 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-ifngr1
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| endothelial cell cell population proliferation increased rate, abnormal | la2Tg; s896Tg + MO2-ifngr1 | standard conditions |
Fig. S4
from Sawamiphak et al., 2014 |
1 - 1 of 1
Citations
- Chen, S.N., Gan, Z., Hou, J., Yang, Y.C., Huang, L., Huang, B., Wang, S., Nie, P. (2022) Identification and establishment of type IV interferon and the characterization of interferon-υ including its class II cytokine receptors IFN-υR1 and IL-10R2. Nature communications. 13:999
- Levitte, S., Adams, K.N., Berg, R.D., Cosma, C.L., Urdahl, K.B., Ramakrishnan, L. (2016) Mycobacterial Acid Tolerance Enables Phagolysosomal Survival and Establishment of Tuberculous Infection In Vivo. Cell Host & Microbe. 20:250-258
- Sawamiphak, S., Kontarakis, Z., Stainier, D.Y. (2014) Interferon Gamma Signaling Positively Regulates Hematopoietic Stem Cell Emergence. Developmental Cell. 31:640-653
- Aggad, D., Stein, C., Sieger, D., Mazel, M., Boudinot, P., Herbomel, P., Levraud, J.P., Lutfalla, G., and Leptin, M. (2010) In Vivo Analysis of Ifn-γ1 and Ifn-γ2 Signaling in Zebrafish. Journal of immunology (Baltimore, Md. : 1950). 185(11):6774-6782
1 - 4 of 4
Show